Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx

Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx

Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx

... The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel Eisaku Yoshihara, Hideaki Maseda and Kohjiro Saito Department of Molecular Life ... has been demonstrated to be acylated [34]. Characterization of OprM The outer membrane components of the multidrug efflux pumps in P. aeruginosa hav...

Ngày tải lên: 23/03/2014, 21:21

8 317 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... revealed the localization of this inhibitor at vacuolar membranes. Results Membrane- binding properties of I C In an attempt to detect and characterize the membrane binding of I C , a member of the ... stationary growth phase, suggesting that I C is specifically associated with the vacuolar membranes rather than the other cellular membranes. The lipid composition of...

Ngày tải lên: 19/02/2014, 05:20

10 646 1
Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

... revent the FP from immersing too d eeply into the apolar core of the membrane. Our data are also compatible with the observation that truncation of t he membrane- spanning region of HA2 to the extent ... loose a ssociation for the peptide in the membrane bilayer. Self-assembly can also b e analyzed by compositional variation of rhodamine-labelled p eptide, keepin...

Ngày tải lên: 19/02/2014, 16:20

12 590 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... N2 of the base makes a hydrogen bond to a main chain car- bonyl. Binding of a xanthine base from XMP in the same position, would lead to the loss of a hydrogen bond and a less favorable interaction. ... this work Present address Center for Biomembrane Research, Department of Biochemistry and Biophysics, Stockholm University, Sweden Database Structural data are avail...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR Zftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCR Zf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACE Zf3¢ tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCR Zffoxp3-R...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... with the Yersinia YpkA D27 0A mutant strain, Prof. James R. Bliska (University of California-Berkeley, USA) for the Yersinia pseudotuberculosis contact A mutant strain, Dr C. Garrison Fathman (Stanford ... isolated from a buffy coat (National Blood Centre) were transfected using the Amaxa Nucleofec- tor system (Amaxa ⁄ Lonza, Cologne, Germany) with the Human Monocyte Nucleofe...

Ngày tải lên: 16/02/2014, 15:20

16 655 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

... taken from [44]. Chicken H101 a- STAAPP AmKA K A K A T K K K 2m ⁄ fKK dNK H110 a- STAAPA AK A K A K AT K KK 2m ⁄ fKK dNK H102 a- STAAPS AK A K P K ATK KK 2m ⁄ fKK dNK H103 a- A pTAAPA AK A K A K ATK ... DK H1.1 a- pS pTAASaKPaK mKA K K A pSQ K ufKK a ⁄ mKN aK H1.2 a- pSAAAAaKAKKmKR a ⁄ mK pS pSK aK ufKK a ⁄ mKN afK H1.3 a- STAAP2mK pTKKT Ra ⁄ mK pS pS ua ⁄ mK a...

Ngày tải lên: 18/02/2014, 08:20

13 633 0
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

... reductase SREBP-2 NADPH Pyruvate Acetyl-CoA Citrate acetyl-CoA Oxaloacetate Oxaloacetate ACL ACC HMG-CoA HMG-CoA synthase Citrate Malonyl-CoA Palmitate Malate Mitochondria FAS ACC SCD Fatty acid ... indicating a relationship between lipid metabolism and the parasympathetic response that may play a role in arrhythmogenesis. Regulation of sulfonylurea channels and other potas- sium ch...

Ngày tải lên: 18/02/2014, 13:20

6 574 1
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... con- tained in the database did not form subgraphs and appeared isolated. The relatively small size of the con- nected graph compared with all the entries in the data- base might be due, at least ... [46]. An analysis of the topological modules of the Fig. 3 (labelled A G) shows that they include structural and ⁄or functional features. Table 3 summarizes the main stru...

Ngày tải lên: 19/02/2014, 07:20

12 511 0
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

... primer, 5¢-GAGA GAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeI site; antisense primer, 5¢-GAGAGAAAGCTTCAAAACT GGGACAGTTG-3¢, HindIII site. The same method was used to amplify the coding sequence for the E.coliMGST, ... to the nucleo- tide sequence 10 655–11 080 in the E. coli genome with a GTG start. Sense primer, 5¢-GAGAGACATATGCCA TCGGCCATTTTAAAG-3¢; antisense primer, 5¢ -GAGA GAAAGCTTC...

Ngày tải lên: 19/02/2014, 17:20

16 525 0
w