Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

... Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii Sandra Pucciarelli 1,2 , Cristina Miceli 1 and Ronald Melki 2 1 Dipartimento ... eukaryotes, an isotype of b-tubulin (b-T1) from the Antarctic ciliate Euplotes focardii, was expressed in Escherichia coli. Folding analysis was per...

Ngày tải lên: 23/03/2014, 21:20

7 501 0
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx

... promoter TGA AGC TGG AAA CCA TCA TTC AAA ACA TTA GCA GGA ATT TTC 52 343 Lower promoter GGA GTT CTG CCA GGG AAC CAC GAC AGG GGA GAA CGC CAC TTA 57 587 Exon 1 GTG CTG CCT GAG AAG GAT TG GAA AGT GCC ... [5] a total absorption of the signal was apparent. Fig. 6. Double staining of cystatin F and ER. (A) Cystatin F was stained with a human cystatin F specific polyclonal antiserum and...

Ngày tải lên: 21/02/2014, 01:21

10 536 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx

... thaliana, Persea americana, Ipomea purpurea, Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), five gibberellin C20 oxidases (Arabidopsis ... (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum, Spinacia oleracea and Marah macrocarpa), hyoscyamine 6b-hydroxylase from Hyoscyamus niger, the iron-deficiency-specific proteins...

Ngày tải lên: 21/02/2014, 03:20

9 864 0
Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc

Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc

... enzyme complex from Carboxydothermus hydrogenoformans After cell breakage and separation of the membrane fraction from the soluble fraction, 80–90% of the hydro- genase activity and 60–70% of the ... 2002 (Applied Biosystems). The accuracy of external calibration was, in general, better than 0.02%. Amino acid sequence analysis Preliminary sequence data of the C...

Ngày tải lên: 23/03/2014, 21:20

10 377 0
Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

Báo cáo Y học: Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids pot

... reverse) and GSP5b (5¢-GT GCATACAACGAAGGCAATCGAGGTCC-3¢, reverse) using Marathon TM cDNA Amplification Kit and Advant- ageÒ cDNA polymerase from Clontech (Heidelberg, Germany) according to the manufacturer’s ... yohimbine, the neuroleptic reserpine, the antihypertensive ajmalicine and the anti- arrhythmic ajmaline. The complex chemical structure of ajmaline, an alkaloid fr...

Ngày tải lên: 24/03/2014, 03:21

10 650 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

... another catalytic pathway. Mg 2+ and Ca 2+ did not affect NaoA activity, and are therefore probably not necessary for the oxidation. However, Cu 2+ strongly inhibited the activity of NaoA, and Mn 2+ slightly ... coli. Purification and characterization of NaoA Protein extracts of BL21(DE3)/pNA101 were separated by gel filtration, anion-exchange column chromatography, and ultr...

Ngày tải lên: 31/03/2014, 08:20

6 255 0
Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

... such as Asia, Africa, Pacific Islands and the Arctic and the rate of HBsAg positivity ranges from 8% to 15%. In the low endemic area, such as Western countries, HBV is predominantly a disease of ... Africa. Genotype B and C are common in Asia; genotype D, in southern Europe, the Middle East, and India; genotype E, in West Africa and South Africa; genotype F, in S...

Ngày tải lên: 02/11/2012, 11:17

5 450 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw ... 5¢-CGCTCGAGA TGAAAATTGACATC GCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGT GCT ATTCTACCAAAAGAATGGCC-3¢ and its complement for His8Ala (substituted nucleotides...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo Y học: Intracellular localization and transcriptional regulation of tumor necrosis factor (TNF) receptor-associated factor 4 (TRAF4) pdf

Tài liệu Báo cáo Y học: Intracellular localization and transcriptional regulation of tumor necrosis factor (TNF) receptor-associated factor 4 (TRAF4) pdf

... The TRAF proteins are characterized by a C-terminal homology domain of about 200 amino acids, called the TRAF domain. The TRAF domain mediates homo- and hetero- merization of TRAF proteins and ... middle panel). The GFP-tagged TRAF domains of TRAF2 and TRAF3 also localized to the cytoplasm whereas the TRAF domain of TRAF1 showed nuclear and cytoplasmic localizat...

Ngày tải lên: 21/02/2014, 15:20

11 468 0
Từ khóa:
w