Báo cáo khoa học: Ascorbic acid induces a marked conformational change in long duplex DNA doc

... Ascorbic acid induces a marked conformational change in long duplex DNA Yuko Yoshikawa 1,5 , Mari Suzuki 1 , Ning Chen 2 , Anatoly A. Zinchenko 2 , Shizuaki Murata 2,5 , Toshio Kanbe 3 , Tonau ... of ascorbic acid at physiological pH. Surprisingly, we found that ascorbic acid generates a pearling structure in a giant DNA molecule, in which elongated an...

Ngày tải lên: 23/03/2014, 21:20

... surgery, pre-eclampsia, and genitourinary, gastrointestinal, car- diovascular and musculoskeletal diseases [3–9]. Extra- cellular fluids such as plasma are characterized by a lower thiol : disulfide ratio in ... evoked a dra- matic increase in blood cysteine in rats. Our data suggest that inter-organ exchange of cysteine occurs, that cysteine derives from both glutathione via c-glutam...

Ngày tải lên: 16/03/2014, 02:20

... involved in PARP degra- dation and DNA fragmentation via caspase-3 process- ing. However, AEBSF also blocked PARP degradation and DNA fragmentation in the absence of caspase-3, indicating that serine ... proteases are involved in nuclear changes via caspase-3-independent pathways. As DEVDase activity plays an important role in OA-induced DNA fragmentation in caspase-3-deficient...

Ngày tải lên: 22/03/2014, 21:20

... Boston, MA, USA). Quantitative RT-PCR Total RNA from RAW 264.7 macrophages was extracted using Rnaeasy Mini Kit (Qiagen spa, Milan, Italy) and RNase-Free DNase Set (Qiagen) according to the manufac- turer’s ... FEBS 73 Ascorbic acid- pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages Sonia Scarfı ` 1,2 , Umberto Benatti 2 , Marina Pozzolini 1,2 , Eman...

Ngày tải lên: 23/03/2014, 10:20

... identified as an interaction partner for ADAM10 that enhances a- sec- retase shedding of APP, probably by regulating matu- ration of the prodomain of ADAM10 [22]. The catalytical domain of ADAM10 contains ... consists of a prodo- main, a catalytical domain with a conserved zinc bind- ing sequence, a cysteine-rich disintegrin-like domain, a transmembrane domain and a rather short c...

Ngày tải lên: 16/02/2014, 09:20

... mechanism of a- proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase 1 What is the role of quinonoid intermediates? Nicolai G. Faleev 1 , Tatyana V. Demidkina 2 , Marina A. ... N.N. & Braunstein, A. E. (1947) Labilization of a- hydrogen of amino acids under the action of aminoferase. Biokhimia 12, 556–568 (in Russian). 2. Esaki, N., Nakayuma, T., Sawada, S., Ta...

Ngày tải lên: 19/02/2014, 16:20

... observed at HepIII in H. in uenzae LPS [16,18,40,41]. The lic 3A gene, which has been shown to encode a sialyltransferase that adds Neu5Ac in an a- 2,3- linkage to lactose in other H. in uenzae strains, ... the monosaccharide sequence and branching pattern. Characterization of the Kdo-lipid A- OH region. ESI-MS data (Table 1), fatty acid compositional analysis (yielding 3-hydro...

Ngày tải lên: 08/03/2014, 02:21

... modifica- tions include cleavage of N-terminal or C-terminal fragments, phosphorylation, and glycosylation of amino -acid residues [13]. The latter is a remarkable characteristic of many archaeal and some bacterial S-layer ... and nonlinear optics or catalysts [2,3,5,6,9–11]. General aspects of S-layers S-Layer proteins are widely distributed in the major lineages of archaea and in Gram...

Ngày tải lên: 16/03/2014, 12:20

... as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCG GCCACCGTGT ACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ACGTC-3¢) ... I441 and G463 to T469, superpose well between the two proteins, arguing against a major con- formational change of the loop. Structural data are available in the Protein Data Bank...

Ngày tải lên: 23/03/2014, 03:20

... (TTTGTTTAACTTTAAGAAGG AGATATA CATATGAATCG) and AmyRev-NcoI (aaaac catGGGCTTTGTTAGCAGCCGGAT). The amplified fragment was ligated into the NdeI and NcoI sites of pSY1 [30]. A derivative (pSY-AmyH_KK) was also ... twin lysines (AmyH- KK). The primers used for Quickchange mutagenesis were AmyKKfor (CCGGCAGTAAGCAGGCGTCTaagaaaACC GTTCTGAAAGGAATCG) and AmyKKrev (GGCCGTC ATTCGTCCGCAGAttctttTGGCAAGAC...

Ngày tải lên: 23/03/2014, 06:20