... mut GCCTTTCTCGGGGCCGCTTCAGCGTGGGAACG P Sp1 middle mut GGCGCCCGCCCCCGGCCATACCACAGCCTTTCTCGG P Sp1 proximal mut GCGGGCGCCCGAACCCTGCCCGCCCCACA P intron IIIfoward ATATTCTAGGATCCTGGCTCATTCACTGCTGTCAC P intron IIIreverse ATATTCTAGGATCCCGGCTTCCCCCTCCCTGCAG P HIF-1a ... reverse CTCGCGGGCTCGGCAGTGGGAG P prom+1 AGTCTATTCTCGAGCACCTGGGACTACAGG P prom+2 AGTCTATTCTCGAGCCCAAAGCGCTGAGATTACAG P prom+3 AGTCTAT...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Disease-related mutations in cytochrome c oxidase studied in yeast and bacterial models pptx
... for protons [21]. Mutations in mitochondrially encoded subunits of cytochrome oxidase in humans: correlating pathogenicity to the biochemistry elucidated in yeast and bacterial models Mitochondrial genes ... & Rich, P.R. (1993) Rapid screening of cytochromes of respiratory mutants of Saccharo- myces cerevisiae – application to the selection of strains containing novel...
Ngày tải lên: 23/03/2014, 21:20
... structure of cytochromes c exhibits clear differ- ences from that of the well-known Ambler’s class I cytochromes c. The class I cytochromes c are spherical proteins with a hexacoordinate heme covalently ... thermoluteolus cyto- chrome c (PHCP) and H. thermoluteolus cytochrome c 552 (PH c 552 ) genes are indicated as c and c 552 , respectively. The arrow and arrowhead indic...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc
... nucleotides 50–96 and the second intron included nucleotides 210–253 in each gene. Excluding introns and stop codons, the c- T1 and c- T2 coding regions were each 1383 bp in length and predicted proteins ... testing via site-direc- ted mutagenesis and functional analysis of c- tubulins in several model systems, including the yeasts Saccharo- myces cerevisiae and Schizosac...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Bilayer localization of membrane-active peptides studied in biomimetic vesicles by visible and fluorescence spectroscopies pptx
... fluorescence quenching induced by each peptide (Fig. 6) echoes the colorimetric and SR data. Magainin, for example, induced the fastest quenching among the three peptides in both vesicle models ... reflecting its pronounced lipid–water interface binding and interactions. The hydrophobic sequence KAL, on the other hand, seemed to affect the fluorescence quenching to a much lesser degree co...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: A new bright green-emitting fluorescent protein – engineered monomeric and dimeric forms pptx
... (or CD) and AC (or BD) interfaces, as illustrated in Fig. 2A. The AB interface is dominated by hydrophobic interactions, whereas the AC interface is comprised predominantly of salt bridges and ... 382 nm in 1 m HCl [39]. For yellow FP, Venus, the EC of the chromophore was back-calculated using 22 000 m )1 Æcm )1 at 280 nm in 10 mm Tris ⁄ HCl. Fluorescence spectroscopy Fluorescence e...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Tetracysteine-tagged prion protein allows discrimination between the native and converted forms pptx
... as controls (gray). Cells were stained with FlAsH (B) or CrAsH (C) , and imaged under the confocal microscope. In cells that express TCC (Bb and Cb) and TCN (Bc and Cc), FlAsH and CrAsH selectively ... structure, with characteristic minima at 210 nm and 222 nm in the far-UV CD spectrum. The spectra of TCC, TCN and TCL overlap the spectra of mPrP, indicating that the secondar...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf
... studied naturally occurring and recombinant protein C Gla domain variants for soluble (s)EPCR binding, cell surface activation to activated protein C (APC) by the thrombin–thrombomodulin complex, and phospholipid dependent ... 7.2–115 n M). (C) Complete EPCR ⁄ protein C binding cycle. 1, Wildtype sEPCR (800 ng) was injected across the flow cell of a CM5 sensor chip coated with RCR-...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "Scaling Phrase-Based Statistical Machine Translation to Larger Corpora and Longer Phrases" pptx
... morocco confirm that spain declined to aid morocco that spain declined to aid morocco spain declined to aid morocco declined to aid morocco to aid morocco aid morocco morocco spain declined to confirm ... that spain declined to aid morocco declined to aid morocco confirm that spain declined to aid morocco aid morocco that spain declined to aid morocco spain declined to confirm that spain decl...
Ngày tải lên: 17/03/2014, 05:20
Báo cáo khoa học: "From Single to Multi-document Summarization: A Prototype System and its Evaluation" pptx
... sentence containing “Milan Kucan” has a higher score than a sentence contains only either Milan or Kucan. A sentence containing both Milan and Kucan but not in consecutive order gets a lower score ... the individual key concepts available, we proceed to cluster these concepts in order to identify major subtopics within the main topic. Clusters are formed through strict lexical c...
Ngày tải lên: 17/03/2014, 08:20