0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

... residues of the protein (assumedtobe140) ,A 90°is the absorption with the 90 °polarizer, and S are order parameters calculated from the ratio of the parallel and perpendicular absorption bands. ... breast adenocarci-noma, were obtained from the Istituto ZooprofilatticoSperimentale della Lombardia e dell’Emilia, Brescia, Italy.Lipids. A series of natural and synthetic lipids and derivatives ... calculated from the corrected spectra, that with suffix L from the lipid alone, and that with suffix amide I¢ from the protein alone. The order parameter for the a- helix, S a , was obtained usingthe...
  • 12
  • 492
  • 0
Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

... induced by the proteinswas expressed as a percentage of the maximal permeabiliza-tion obtained at the end of the assay by the addition of Triton X-100 to a final concentration of 2 mm.Hemolytic activityHemolytic ... measured the interaction of stefin B with various combinations of phospholipid monolayers and bilayers. Interaction of stefin B in the prefibrillaraggregated state with model lipid membranes wasprobed ... mol ⁄mol). The results are mean ± SD, n ¼ 1–4. The degree of permea-bilization is expressed as the percentage of the maximal valueobtained at the end of the assay by the addition of 2 mM TritonX-100....
  • 10
  • 476
  • 0
Báo cáo khoa học: Interaction of an  40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf

Báo cáo khoa học: Interaction of an  40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf

... procedures in accordance with the guidelines of the Institutional Animal Ethics C ommitteeat the Jawaharlal Nehru University, New Delhi. Animalswere fed water and standard rat chow ( Hindustan LeverLtd, ... ract p repared at 24 h after surgery (lanes 5 and 6). An a lmost complete d isappearance of complex C 1 (lanes3 and 4) suggests that an additional factor, designated asregenerating rat liver ... nteracting with )148 to )124 region of c-jun after partial hepatectomy. (A) TimeofappearanceofcomplexC2 after p artial hepatectomy. EMSA were carried out using 1 ng of labelled Jun-25 and nuclear...
  • 11
  • 438
  • 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

... PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaGTCGACaatgcAntisense ARS with PstI and SalI gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP CcttctccccggcggttagtgctgagagtgcARS aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaS. Ma et al. PABP expression during heat ... that, due to the increasedcellular abundance of HSP27, there was an overallCMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’...
  • 19
  • 596
  • 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... pro-caspase 9 and caspase 9. (C) Cells were treated with EGF and ADR as describedin (A) . Lysates were prepared at the indicated times after the ADRaddition and analyzed for caspase 9 activity by ... cells by activating apoptotic pathways. The intracellularmachinery responsible for apoptosis depends on a fam-ily of cysteine aspases (caspases), and action of the two main apoptotic pathways, the ... Healthcare).Caspase 9 activity assayCaspase 9 activity was examined according to the instruc-tion manual of the Caspase 9 ⁄ Mch6 Fluorometric ProteaseAssay kit (Medical and Biological Laboratories...
  • 13
  • 493
  • 0
Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx

Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx

... phosphate buffer was used at pH valuesbetween 2 and 3, acetate buffer at pH values between 4 and 5, and phosphate buffer at pH values between 6 and 8. Inall cases the concentration of the buffer ... during mycoparasitic interaction. (A) Sche-matic representation of the confrontation assay, samples were taken from the interaction area (In) between Trichoderma strains (T) and B. cinerea B98 (Bc) ... signal was detec-ted in the T. asperellum vs. T. asperellum interaction (Fig. 3). No signal was detected during the interaction of T. harzianum and B. cinerea and T. harzianum with itself.Table...
  • 7
  • 552
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Interaction of Knowledge Sources in a Portable Natural Language Interface" docx

... This paper describes a general approach to the design of natural language interfaces that has evolved during the development of DATALOG, an Eng- lish database query system based on Cascaded ATN ... describing the interaction between syntax and semantics, and then the interaction between general knowledge and domain knowledge. 2. Overview of DATALOG Architecture The architecture of DATALOG ... is based on Cas- caded ATN grammar, a general approach to the design of language processors which is an exten- sion of Augmented Transition Network grammar [13]. The Cascaded ATN approach...
  • 4
  • 253
  • 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... deamidated before any other resi-due. In a similar fashion, the samples with 1.8, 3.7 and 4.4 Da increases show that Asn71 and Asn94 arenearly equally reactive as the next sites, followed by Asn34 ... mass accuracy [6,18,23,34].Furthermore, these fragment mass values originate from the same molecular ions, so they must all becharacteristic of that protein s sequence and molecularmass value. ... modifications of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an adduct increase, orno change, the value had unexpectedly decreased from 22...
  • 13
  • 572
  • 0
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

... 3 with lanes 2 and 4). We also observed that bothGST-ExoS(DALDL424–428AAAAA) and GST-ExoS-(LDL426–428AAA) lack the ability to interact with 14-3-3 proteins from whole cell lysates of HeLa cells(Fig. ... on interactions with 14-3-3 and factor activating ExoS (FAS) protein cofactors[24–26].As this interaction is necessary for the ADP-ribosyla-tion activity of ExoS, and more intriguingly appearsto ... Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activityLubna Yasmin1,*, Anna L. Jansson1,*, Tooba Panahandeh1, Ruth H. Palmer3, Matthew...
  • 9
  • 525
  • 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... SequenceForward ompA* 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAGReverse ompA105 5¢-GCCATGAATATCTCCAACGAGReverse ompA117 5¢-CATCCAAAATACGCCATGAATATCForward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCGReverse ... 5¢-GCTTCAGTACTTAGAGACForward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACCReverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGGForward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse ... 5¢-GGGAATTCCATATGGCTAAGGGGCAATC and 5¢-AGGATCGCTGGATCCCCGTGTAAAAAAAC, respectively, with pTX367 plasmid [8], creating an NdeIsite that included the translation initiation codon and a BamHI site downstream of the...
  • 10
  • 488
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ