Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

... residues of the protein (assumedtobe140) ,A 90° is the absorption with the 90 ° polarizer, and S are order parameters calculated from the ratio of the parallel and perpendicular absorption bands. ... breast adenocarci- noma, were obtained from the Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia, Brescia, Italy. Lipids. A series of natural a...

Ngày tải lên: 23/03/2014, 21:20

12 492 0
Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

... induced by the proteins was expressed as a percentage of the maximal permeabiliza- tion obtained at the end of the assay by the addition of Triton X-100 to a final concentration of 2 mm. Hemolytic activity Hemolytic ... measured the interaction of stefin B with various combinations of phospholipid monolayers and bilayers. Interaction of stefin B in the...

Ngày tải lên: 07/03/2014, 17:20

10 477 0
Báo cáo khoa học: Interaction of an  40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf

Báo cáo khoa học: Interaction of an  40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf

... procedures in accordance with the guidelines of the Institutional Animal Ethics C ommittee at the Jawaharlal Nehru University, New Delhi. Animals were fed water and standard rat chow ( Hindustan Lever Ltd, ... ract p repared at 24 h after surgery (lanes 5 and 6). An a lmost complete d isappearance of complex C 1 (lanes 3 and 4) suggests that an additional factor, designate...

Ngày tải lên: 16/03/2014, 18:20

11 438 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

... PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc Antisense ARS with PstI and SalI gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG TOP ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG TOP Ccttctccccggcggttagtgctgaga...

Ngày tải lên: 18/02/2014, 12:20

19 597 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc

... pro-caspase 9 and caspase 9. (C) Cells were treated with EGF and ADR as described in (A) . Lysates were prepared at the indicated times after the ADR addition and analyzed for caspase 9 activity by ... cells by activating apoptotic pathways. The intracellular machinery responsible for apoptosis depends on a fam- ily of cysteine aspases (caspases), and action of the...

Ngày tải lên: 19/02/2014, 06:20

13 494 0
Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx

Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx

... phosphate buffer was used at pH values between 2 and 3, acetate buffer at pH values between 4 and 5, and phosphate buffer at pH values between 6 and 8. In all cases the concentration of the buffer ... during mycoparasitic interaction. (A) Sche- matic representation of the confrontation assay, samples were taken from the interaction area (In) between Trichoderma strain...

Ngày tải lên: 19/02/2014, 16:20

7 552 0
Báo cáo khoa học: "Interaction of Knowledge Sources in a Portable Natural Language Interface" docx

Báo cáo khoa học: "Interaction of Knowledge Sources in a Portable Natural Language Interface" docx

... This paper describes a general approach to the design of natural language interfaces that has evolved during the development of DATALOG, an Eng- lish database query system based on Cascaded ATN ... describing the interaction between syntax and semantics, and then the interaction between general knowledge and domain knowledge. 2. Overview of DATALOG Architecture...

Ngày tải lên: 17/03/2014, 19:21

4 253 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... deamidated before any other resi- due. In a similar fashion, the samples with 1.8, 3.7 and 4.4 Da increases show that Asn71 and Asn94 are nearly equally reactive as the next sites, followed by Asn34 ... mass accuracy [6,18,23,34]. Furthermore, these fragment mass values originate from the same molecular ions, so they must all be characteristic of that protein s sequence...

Ngày tải lên: 18/02/2014, 16:20

13 572 0
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

... 3 with lanes 2 and 4). We also observed that both GST-ExoS(DALDL424–428AAAAA) and GST-ExoS- (LDL426–428AAA) lack the ability to interact with 14-3-3 proteins from whole cell lysates of HeLa cells (Fig. ... on interactions with 14-3-3 and factor activating ExoS (FAS) protein cofactors [24–26]. As this interaction is necessary for the ADP-ribosyla- tion activity of Exo...

Ngày tải lên: 19/02/2014, 08:20

9 525 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... Sequence Forward ompA* 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC Forward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG Reverse ... 5¢-GCTTCAGTACTTAGAGAC Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG Forward rpsO...

Ngày tải lên: 19/02/2014, 16:20

10 488 0
w