Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot
... aspects of comparative studies at the subcellular level In addition to the description of the proteome of a subcellular entity, the analysis of dynamic proteome chan- ges at a subcellular level promises ... post-translational modifications that affect the migration behaviour of the protein on the 2D gel. Despite the exceptional analytical power of...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
... accordance with the guidelines of the Ministry of Education, Science, Sports and Culture of Japan for the use of laboratory animals. Cell fractionation Subcellular fractions of rat liver were prepared ... with partial digestion of the surface lamina of the nuclear matrix to allow penetration of the gold particles into the nuclear matrix [19] and the export me...
Ngày tải lên: 30/03/2014, 20:20
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... embryo- genesis, all the evidence suggests that sex determination might disobey the conventional rules of evolutionary conservation. The common picture emerging here is that the genes at the top of the cascade ... activity in the fish ovary [47,48]. Given the abovementioned observation that estrogens repress male differentiation it appears that, once initiated, factors o...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Gene silencing at the nuclear periphery pdf
... degeneration of the caudate nucleus, putamen, and occasionally the globus pallidus, with little involve- ment of the rest of the brain. The question of how mutations in the same gene or group of ... euchromatin at the nucleoplasm, and of gene-silenced condensed heterochromatin at the vicinity of the INM are circled. In the latter state, epigenetic modifica...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
... resulted in an increase in the ratio of intermediate to mature cyto- chrome c 1 and a disappearance of the intermediate form of the Rieske protein. At the same time, the levels of subunits 7, 8 and ... around the catalytic core of the enzyme to arrive at the three dimen- sional organization revealed by the crystal structures (Fig. 1A). The supernumerary sub...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... other amino acids situated in the vicinity of these residues. The results confirmed the importance of the amino acid residues, all located at the putative catalytic domain, for the GCPII hydrolytic ... °C ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT 44/716 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 4 min/72 °C AAACTCGAGTTATTATTCAATATCAAACAGAG 59/750 AAAAGATCTAAAGCATTTT...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... ending at nucleotide 16 295 of the genome ([20] see Fig. 1). Since the RNA is polyadenylated, it is uncer- tain if the termination occurs at the C residue at 16 293 or the A residue at 16 295 of the ... populations of H-strand transcripts escape termination at the mt-TERM and continue through the distal sites of the genome. Studies from two laboratories sho...
Ngày tải lên: 08/03/2014, 08:20
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... studies demonstrate that miR-23a potently promotes the growth of the gastric adeno- carcinoma cell line MGC803, providing the first proof- of- concept that there is a potential link between the tumor ... expression. These data highlight the prediction that IL6R is a direct target of miR-23a. miR-23a negatively regulates IL6R expression at the mRNA and protein levels miRNAs c...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf
... the cleft of actin protomers located in the vicinity of the barbed end of the filament, pro- ducing an ATP or ADP–Pi cap at this end. Because of the presence of this cap at the barbed end the critical concentration ... while at pH 6.5 the acceleration of the cleavage was lar- ger in the absence of Pi than in its presence. We also studied the effect of...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc
... postulate two pathways for the catabolism of CH 3 -4-aminobutyrate that is generated from the side chain of 2,6-dihydroxypseudooxynicotine [7]. The first would start with the oxidative demethylation ... RT-PCR analysis of transcripts. (A) Schematic representation of the pAO1 gene and ORF cluster flanked by Tn554 and DTn. The cluster consists of the pmfR gene, encoding...
Ngày tải lên: 19/02/2014, 07:20