Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... made of a catalytic nucleophile serine, associated to a proton c arrier histidine and a c harge r elaying aspartic (or glutamic) acid. To further investigate the biochemical characterization of ... connecting strand b3 to helix a1 and two small h elices (a4 anda6). The catalytic site consists of a functional catalytic triad found in all serine enzymes of the a/...

Ngày tải lên: 07/03/2014, 16:20

9 584 0
Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

... CTGACAATTGAT NNNGAAGCAGGCATGACAGG E15 0A Zinc binding ACTATTGATGAA GCCGCGGGCATGACAGGTGC D17 3A Zinc binding CCTTCTAAATACA GCTAGCGAACAAGAAGGCG H46 1A Zinc binding CCAACCATCAAGTTCCCT GCTAGCCCAGATGAG Characterization of V. alginolyticus ... CGCTCGGGGCA GCTAACGGCATCGGCATGGC D119X Zinc binding CGCTCGGGGCA NNNAACGGCATCGGCATGGC E14 9A General base CTGACGATCGAT GCAGAAGCAGGCATGACAGG E149X Gene...

Ngày tải lên: 23/03/2014, 06:20

14 304 0
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

... Molinaro RJ, Jha BK, Malathi K, Varambally S, Chin- naiyan AM & Silverman RH (2006) Selection and clo- ning of poly (rC) -binding protein 2 and Raf kinase inhibitor protein RNA activators of ... discovered as a part of the interferon antiviral pathway in mammals [1,2]. In higher animals (vertebrates), when activated by dsRNA, 2- 5A synthetases catalyze the polymerizat...

Ngày tải lên: 23/03/2014, 09:20

13 429 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

... 2003 Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme Catharina T. Migita 1 , Xuhong Zhang 2 and ... Katakura, K., Tomita, T., Zhang, X., Sun, D., Sato, M., Sasahara, M., Kayama, T., Ikeda-Saito, M. & Yoshida, T. (2000) Histi...

Ngày tải lên: 23/03/2014, 20:22

12 459 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... one a subunit and the c ⁄ e subunits and the other between the second a subunit and the d subunit [4]. The c ⁄ e and d subunits play a major role in shaping the ligand-binding sites and also in ... loss and the weakness and fatigability of the voluntary muscles, the main symptoms of MG [9]. A proportion of patients lacking autoantibodies again...

Ngày tải lên: 30/03/2014, 10:20

12 394 0
Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

... 1979 Immunocytochemistry analysis of f-actin and vinculin distribution The distribution of vinculin was assessed with a primary antibody against vinculin (Sigma) detected by secondary antibody conjugated with Alexa ... prolifera- tive and differentiation state, basal level of ERK1 ⁄ 2 and Akt kinase phosphorylation, and P2Y 1 and P2Y 12 receptor protein expression and...

Ngày tải lên: 30/03/2014, 08:20

13 378 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... rat models of myocardial infarction has anti -in ammatory effects, decreasing protein production and gene expression for IL-1b and TNF -a [11]. To address these paradoxes of both pro- and anti -in ammatory ... China Introduction Ischaemic heart disease is a life-threatening condition that may cause sudden cardiac failure and death. Many researchers have investigated cell tran...

Ngày tải lên: 18/02/2014, 04:20

11 653 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... pulchellin A- chains, the residues involved in the active site cleft are the same as in abrin and ricin A- chains. This suggests that the catalytic reaction is exactly the same. The sugar binding pulchellin ... galactose-containing structures, can agglutinate human and rabbit erythrocytes, and kills mice and the microcrustacean Artemia salina at very low concentr...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

Tài liệu Báo cáo khoa học: Expression and function of Noxo1c, an alternative splicing form of the NADPH oxidase organizer 1 doc

... in the testis and fetal brain. The Noxo1c protein contains an additional five amino acids in the N-terminal PX domain, a phosphoinosi- tide-binding module; the domain plays an essential role in ... Noxo1 and p47 phox were constructed for expression as a hemaglutinin (HA)- tagged protein, Noxa1 and p67 phox as a myc-tagged pro- tein, and p22 phox as a protein wit...

Ngày tải lên: 19/02/2014, 06:20

15 633 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... detailed analy- sis of the exact reaction mechanisms. The tyrosinase structure, wherein the active site was located at the bottom of a large vacant space and one of the six his- tidine ligands appeared ... TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. Th...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
w