0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

Báo cáo khoa học:

Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

... METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM Shin-ichiro Kamei* & Takahiro Wakao Computing Research Laboratory New Mexico State University ... article we outline a basic approach to treating metonymy properly in a multil- ingual machine translation system. This is the first attempt at treating metonymy in an machine translation environment. ... that the main factors for treating metonymy correctly in a multil- ingual machine translation system are 1) its universality, which can be a guideline for the analysis component, 2) language...
  • 3
  • 453
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... participated in the collection and interpreta-tion of the data and were involved in drafting the manuscript.MG participated in analysis and interpretation of the data and in drafting the manuscript. ... study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and approved the final manuscript.AcknowledgementsAll residents, clinical fellows and intensivists ... clinically relevant and irrelevant findings, and simplyreported on all abnormalities [12]. At present, in many ICUsCXRs are still routinely obtained on a daily basis, at least in TheNetherlands...
  • 7
  • 722
  • 0
Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx

Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx

... anHFB1-like protein, which, after N-terminal processing(MKFFTAAALFAAVAIA), C-terminal processing(AVGA) and disulfide bond formation, has a mass of 7743 Da.T. longibrachiatumThe main mass peak of T. longibrachiatum ... the range of 5–10 kDa, typically including two dominating peaksat approximately m ⁄ z 7000. As mycelia and sporeslargely remained intact, and the extraction solutioncontained acetonitrile and ... than six small proteins; (b)known cleavage sites of signal peptidases and fungalKex2-like proteinases; and (c) actual structural studies of H. jecorina HFB1 and HFB2. In H. jecorina, maturation...
  • 12
  • 632
  • 0
Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

... 623–628.5 Nakamura E, Sato M, Yang H, Miyagawa F, HarasakiM, Tomita K, Matsuoka S, Noma A, Iwai K & MinatoN (1999) 4F2 (CD98) heavy chain is associated cova-lently with an amino acid transporter ... fluorescein isothiocyanate. (A) Labeling of surface antigens on intact BeWo cells. (B) Labeling of surface and intracellular antigens aftercell permeabilization. n ¼ number of cell samples. A1 B A 2Fig. ... shown).Galectin 3 and CD98 co-immunoprecipitateWe have previously postulated a role for galectin 3,an S-type lectin containing a carbohydrate-bindingdomain, as a physiological ligand of CD98 in vivo...
  • 13
  • 385
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

... training sets of varying sizes, as wellas a test set of 1000 dialogs. Each generated dialogd in each training/test set consisted of a sequence of values for all the observed and unobserved variables:d ... expectation and its maximization are easy to compute. This is becauseour dialog model has a chain-like structure thatclosely resembles an Hidden Markov Model, so a forward-backward procedure can ... corpora are usu-ally small and sparse. In this work, we propose a method of building user models that does not oper-ate on manually transcribed dialogs, but instead usesdialogs that have been transcribed...
  • 4
  • 470
  • 0
Báo cáo khoa học: Lithium increases PGC-1a expression and mitochondrial biogenesis in primary bovine aortic endothelial cells ppt

Báo cáo khoa học: Lithium increases PGC-1a expression and mitochondrial biogenesis in primary bovine aortic endothelial cells ppt

... Mitochondria Fwd: CAACCCCAAAGCTGAAGTTCTRev: CCTTGCGTAGGTAATTCATTCMitRNA polymerase Nuclear Fwd: GGACTCCACACACATGATGCRev: GAACCTGGACAGGTCATGGAGMitDNA polymerase Nuclear Fwd: GGACTCCACACACATGATGCRev: ... GGCATGAACCCTTTGTAGAAGMit-transcription factor A (TFAM)Nuclear Fwd: GGGAGGAACAAATGATGGAARev: CCATGGGCTACAGAAAAGGAMit-transcription factor B2(TFB2)Nuclear Fwd: GTACAAGTCCCGTTCCGAGACRev: CACTCTGGCACCACTTTCAAGNRF1 ... GCTTTGGCAAAACCTCAGATRev: ACCAGCCTTCCTCATCTCCTATP synthase subunit b Nuclear Fwd: ACAGGACCCTATGTGCTTGGRev: ATCAGCAAATTCCCCAACAGUncoupling protein-2 Nuclear Fwd: ATGACAGACGACCTCCCTTGRev: GGCATGAACCCTTTGTAGAAGMit-transcription...
  • 17
  • 416
  • 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... ⁄ 2 and a module containing theMuvB proteins Lin-37, Lin-52, Lin-54 and chromatin-associated Lin-9 and Lin-53 ⁄ RBBP4 ⁄ RbAp48.Furthermore, A- Myb and B-Myb were present in immunoprecipitations ... contrast, cyclin B1 and cyclin B2are central to the regulation of progress through thecell cycle (Fig. 1). Cyclins B1 and B2 appear in S phase and accumulate in G2 and mitosis before disappearingat ... toCCAAT-boxes and with Myb proteins associating with a distal Myb site in activating the Cdc2 promoter.Binding of the activating E2Fs during the cell cycle tothe promoter alternates with binding...
  • 17
  • 876
  • 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... participates in growth regulation of human breast carcinoma cells.Oncogene 20, 2499–2513.9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M,Nakajima T, Kawashima T, Nanakin A, Sawabu T,Uenoyama Y ... apoptosis and cell cycle arrest of colon carcinoma cells. Am JPathol 167, 969–980.27 Kunnumakkara AB, Anand P & Aggarwal BB (2008)Curcumin inhibits proliferation, invasion, angiogenesis and metastasis ... (2004) The interaction of specific peptide aptamers with the DNA bindingdomain and the dimerization domain of the transcrip-tion factor Stat3 inhibits transactivation and inducesapoptosis in tumor...
  • 11
  • 558
  • 0
Tài liệu Báo cáo khoa học: Substrate specificity of the pseudouridine synthase RluD in Escherichia coli doc

Tài liệu Báo cáo khoa học: Substrate specificity of the pseudouridine synthase RluD in Escherichia coli doc

... Mannheim, Ger-many) and primers rluD114::cat(pKD3) 5¢ (5¢-GCT ACAATA GCA CAC TAT ATT AAA CGG CAA AGC CGTAAA ACC CCG TGT AGG CTG GAG CTG CTT CG-3¢) and rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT ... H69region.Ribosomal subunit assembly involves folding of rRNA and r-proteins and association of both intofunctional subunits. In addition, post-transcriptionalmodifications are made in rRNA and post-transla-tional ... 2411–2415.3 Kaya Y & Ofengand J (2003) A novel unanticipatedtype of pseudouridine synthase with homologs in bacte-ria, archaea, and eukarya. RNA 9, 711–721.4 Hamma T & Ferre-D’Amare AR (2006)...
  • 8
  • 596
  • 0
Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt

Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt

... role in the focalaccumulation and antigen-induced activation of T cells in inflammatory demyelinating diseases of the PNS.As mentioned above, MAPKs were implicated in theactivation of NF-jB in ... Marlin SD, Rothlein R, Toman C &Anderson DC (1989) Cooperative interactions of LFA-1 and Mac-1 with intercellular adhesion molecule-1 in facilitating adherence and transendothelial migra-tion ... dehydro-genase (GAPDH) was used as an internal control and wasdetected using the following primers: sense, 5¢-TGATGACATCAAGAAGGTGGTGAAG-3¢; antisense, 5¢-TCCTTGGAGGCCATGTGGGCCAT-3¢. Cycling parameters...
  • 11
  • 519
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP