Báo cáo khoa học: "Part of Speech Tagging Using a Network of Linear Separators" pdf

... in applications. We address these claims empirically by applying SNOW to one of the fundamental disambigua- tion problems in natural language: part -of speech tagging. Part of Speech tagging ... task. Finally, we compare our approach to a state- of- the-art tagger, based on Brill's transforma- tion based approach; we show that SNOW- based taggers already achieve re...

Ngày tải lên: 23/03/2014, 19:20

... cellu- lar networks allows the simplification of the set of equations by assuming a steady state of the intra- cellular metabolites. An approach that combines flux balance analysis (FBA) with an ordinary ... unphos- phorylated EIIA inhibits the uptake of other non-PTS carbohydrates by a process called inducer exclusion, whereas phosphorylated EIIA activates adenylate cyclase (CyaA)...

Ngày tải lên: 18/02/2014, 13:20

... overall reaction [50]. A rationally designed variant of L -Ala- D / L -Glu epimerase (a third member of the enolase superfamily, Fig. 8), containing a mutation (D297G) analogous to that of the E223G ... [38]. A transition state analog, shown in a ball-and-stick representation, is bound in each of the active sites, which are located at the trimer interfaces. The location of...

Ngày tải lên: 19/02/2014, 12:20

... GGCTTCCATGGCATACTCCA CARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT E2-14 kDa Ubiquitin-conjugating ... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGAT...

Ngày tải lên: 07/03/2014, 03:20

... FEBS providing a rationale for the use of combinations of MEK1 ⁄ 2 inhibitors and PI3K–PKB pathway inhibitors. Indeed, rapamycin, an inhibitor of mammalian target of rapamycin (mTOR) downstream of PKB, can ... The mutant BCR–ABL tyro- sine kinase activates several signalling pathways, includ- ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and ac...

Ngày tải lên: 16/03/2014, 00:20

... clude all turns that have a repair that just consists of a filled pause or word fragment. On this subset they obtained a correction recall rate of 43% and a precision of 50%. Nakatani and Hirschberg ... in this paper, we in- troduce a statistical language model that can de- tect speech repairs, boundary tones, and discourse markers, and can assign POS tags, and can us...

Ngày tải lên: 17/03/2014, 23:20

... parsers. Notably are the constraint-based linguistic frameworks with mathematical rigor, and provide grammatical anal- yses for a large variety of phenomena. For in- stance, the Head-Driven Phrase Structure ... Shared Task, and mark the heads of these rules in a way that will arrive at a compat- ible dependency backbone. For instance, the left most daughters of coordination rules...

Ngày tải lên: 08/03/2014, 00:20

... and citations therein); (ii) compu- tational ease—with just around a thousand cate- gories, the word–category matrix has a manage- able size; (iii) widespread availability—thesauri are available ... to the actual strength of association. In most natural language applica- tions, the strength of association is evidence for a particular proposition. In that case, even if associ- ation...

Ngày tải lên: 08/03/2014, 21:20

... Linguistics Better Automatic Treebank Conversion Using A Feature-Based Approach Muhua Zhu Jingbo Zhu Minghan Hu Natural Language Processing Lab. Northeastern University, China zhumuhua@gmail.com zhujingbo@mail.neu.edu.cn ... (named source parser) on a source treebank, and use it to parse sentences in the training data of a target treebank. Step 2: Build a parser on pairs of gold...

Ngày tải lên: 17/03/2014, 00:20

... parsing that has been draw some in- terests in recent years. Typical domain adaptation tasks often assume annotated data in new domain absent or insufficient and a large scale unlabeled data available. ... two characters of a word char −1 The last character of a word char −2 The last two characters of a word . ’s, i.e., ‘s.dprel’ means dependent label of character in the top o...

Ngày tải lên: 17/03/2014, 01:20