Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

... of the ACL-IJCNLP 2009 Conference Short Papers, pages 97–100,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLPCorrelating Human and Automatic Evaluation of a German Surface RealiserAoife ... of automatic evalua-tion methods for generation in terms of adequacy and ﬂuency on automatically generated Englishparaphrases. They ﬁnd that the automatic metricsare reasonably good at measuring ... nativespeaker judgements on automatically gen-erated German text against automatic eval-uation metrics. We look at a number of metrics from the MT and Summarisationcommunities and ﬁnd that for a...

Báo cáo khoa học: Identiﬁcation and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... HepG2cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two speciﬁc primers For 6I 5¢-CGATGAATTCGTTAACGCTCATCACCATCACCATCACGGGAAATTGGCCATGGGGT-3¢ containing a HpaIsiteandBack6I ... kidney,thymus, liver), and rather weakly in placenta, lung, aorta,amygdala, occipital and parietal lobe and salivary gland.Almost no expression was observed in fetal lung and heart,uterus, bladder, kidney, ... the annealing of the two following synthetic oligonucleotides For EGT 5¢-GATCCGCCACCATGACCATCTTATGTTGGCTCGCTCTCCTGAGCACACTCACAGCTGTTAACGCTGACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCGTTAACAGCTGTGAGTGTGCTCAGGAGAGCGAGCCAACATAAGATGGTCATGGTGGCG-3¢....

Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx

... variants.Table S3. Numbers of cysteine residues of FcRn HCsacross species a .Table S4. Numbers of cysteine residues of nonclassicalMHC class I HC a .This material is available as part of ... dramatically decreased half-life of Fig. 4. Analysis of b2m and hFcRn HCs byMALDI-TOF MS prior to reduction of disulﬁde bonds (aliquot 1). Spectra wererecorded after iodoacetamide treatment and tryptic ... of fractions after large-scale puriﬁcation of anti-FcRn Ig and analyses by nonreducingSDS-PAGE. ELISA analyses of reactivitytowards (D) mutant shFcRn and (E) hb2mfor the corresponding fractions....

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... crosspeaks were assigned and inte-grated, with concomitant cycles of structure calcula-tions for evaluation of distance and angle constraintviolations as well as assignments of additional peaksbased ... 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but ... D-amino acid in peptide link-age by an enzyme from frog skin secretions. Proc NatlAcad Sci USA 102, 4235–4239.33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K &...

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Puriﬁcation of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdeﬁnedastheamountofenzymethatliberatesreducing ... RTARAAYTGNCCNGCRTCYTGLP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTTLP7 AWAWALGWDDKLP8 GYHENALP9 WPLDYFLF2 GCCACACTTCTGTCAACATCC3RAC TTCTTCAAGGGCTGGCTCCCT3AP CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR ... Puriﬁcation and cDNA cloning of a cellulase from abaloneHaliotis discus hannaiKen-ichi Suzuki, Takao Ojima and Kiyoyoshi NishitaLaboratory of Biochemistry and Biotechnology, Graduate School of...

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... temperature until all free waterwas evaporated. After this, IR spectra were recorded atroom temperature and at 37 °C. Usually, the originalspectra were evaluated directly and a spectral analysis ... confersinterspecies variation of a major surface lipoprotein and a macrophage-activating lipopeptide of Mycoplasma fermentans.Infect. Immunol. 67, 760–771.34. Takeuchi, O., Kaufmann, A. , Grote, K., Kawai, T., ... Chicester.32. Mu¨hlradt, P.F. & Frisch, M. (1994) Puriﬁcation and partial bio-chemical characterization of a Mycoplasma fermentans-derivedsubstance that activates macrophages to release nitric oxide,tumor...

Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

... L, Hamid Q & Elias JA (2004) Acidicmammalian chitinase in asthmatic Th2 inﬂammation and IL-13 pathway activation. Science 304, 1678–1682.4 Kasprzewska A (2003) Plant chitinases ) regulation ... chitinaseshave catalytic domains that are at least as large asthose of the plant enzymes and that may contain atleast six subsites [26,30]. However, the catalyticdomains of ChiG, ChiC and most other ... T, Yokokawa S, Saito A, Fujii T, Nikaidou N,Miyashita K & Watanabe T (2006) Comparison of enzymatic and antifungal properties between family 18 and 19 chitinases from S. coelicolor A3 (2)....

Báo cáo khoa học: Identiﬁcation and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKABacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSLBicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV130 ... Mountain View, CA, USA), and poly (A) +RNAwas isolated using Oligo(dT)-Latex Super (Takara ShuzoCo.). cDNA was prepared from mRNA with a Zap-cDNAsynthesis kit (Stratagene, La Jolla, CA, USA) according ... (Shizuoka, Japan), respectively. RNA and DNAmanipulation was generally performed as described previ-ously [9]. Total RNA was extracted from basal tissue of thebarnacle by a Total RNA Separator...

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R,5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GT-cDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTACCTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTTCCAAGTGC-3¢ for GT-cDNA2 (3043 bp).Construction and ... 3¢-RACE were: Primer C, 5¢-CCAGTGTCCCCATCATCAG-3¢ and Primer D, 5¢-GGCAATTTTAAAGTCATTATGGCGCAAA-3¢. First strand cDNAs weresynthesized using Superscript II RNase H–reverse tran-scriptase ... sequencepredicted that gcGLUT is a 12-transmembrane spanningprotein and that it possesses all the major structural features and sequence motifs characteristic of a functional class Iglucose transporter, and...

Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

... respectively, bymeans of standard Lineweaver–Burk analysis of initial ratekinetics. Fitting of the experimental data required as inputdata the initial concentrations of BApNA, enzyme and inhibitor, ... inhibitionassaysTrypsin (TPCK-treated from bovine pancreas), a- chymo-trypsin (TLCK-treated from bovine pancreas), BApNA and GPpNA were purchased from Sigma-Aldrich. Solutions of BApNA and GPpNA were ... distance data by dynamical simulatedannealing from a random array of atoms. FEBS Lett239, 129–136.58 Yip P & Case DA (1989) A New Method for Reﬁne-ment of Macromolecular Structures based...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP