Báo cáo khoa học: "A Semi-Supervised Key Phrase Extraction Approach: Learning from Title Phrases through a Document Semantic Network" docx

... example again, we will find that the key phrase “Internet” can be in- ferred from the title phrase “Web”. As a matter of fact, key phrases often have close semantics to title phrases. Then a ... the title phrases are regarded as labeled samples, while the other phrases as unla- beled ones. That is, the information we have at the beginning about how to rank phra...

Ngày tải lên: 23/03/2014, 16:20

... number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse ... opti- mized metal–ligand distances (Table 2) compare very favorably with data in the protein database, from which an average distance of 2.03 A ˚ for Fe–N(His) was inferred [38], a...

Ngày tải lên: 18/02/2014, 06:20

... 488 nm was carried out with an argon ion laser. Acquired images were analyzed using image-pro plus 4.5 software. Materials o-Aminobenzenothiol was purchased from Fluka (Shang- hai, China). A stock ... 4,5-Dihydroxy- 1,3-benzenedisulfonic acid disodium salt (Tiron) was from Shanghai Reagent Co. Ltd (Shanghai, China). All chemi- cals were of analytical reagent grade, and double-distilled...

Ngày tải lên: 16/03/2014, 11:20

... Authors Journal compilation ª 2005 FEBS Each domain is catalytically active, and both are cap- able of cleaving AI and BK. The ACE gene also gives rise to a second mammalian ACE, known as either ... 65–70. 29 Towler P, Staker B, Prasad SG, Menon S, Tang J, Par- sons T, Ryan D, Fisher M, Williams D, Dales NA, Patane MA & Pantoliano MW (2004) ACE2 x-ray structures reveal a large hinge-b...

Ngày tải lên: 23/03/2014, 11:20

... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and 2xoi Abbreviations PDB, Prot...

Ngày tải lên: 14/02/2014, 22:20

... substrate-free AppA the C a atoms are 2.41 A ˚ apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1.87 A ˚ . Distinct conformational changes ... phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site at the interface of the two domains [4,5]. HA...

Ngày tải lên: 16/02/2014, 09:20

... 701–713. 15 Prabakaran P, An J, Gromiha M, Selvaraj S, Uedaira H, Kono H & Sarai A (2001) Thermodynamic database for protein-nucleic acid interactions (ProNIT). Bioinfor- matics 17, 1027–1034. 16 ... were aligned computationally and the appearance of a base at each position in a motif was presented as a percentage fre- quency of all four kinds of base. The base with a frequency...

Ngày tải lên: 18/02/2014, 13:20

... and ammonia. They belong to a superfamily [1] that includes amidases, acyl transferases and N-carbamoyl- d-amino acid amidohydrolases, and they occur in both prokaryotes and eukaryotes. Their applications ... the bar indicates the fraction assayed. (B) Reducing SDS ⁄ PAGE of the active fraction showed a characteristic nitrilase band of  40 kDa. The contaminating band at 60 kDa was identi...

Ngày tải lên: 19/02/2014, 00:20

... inducing plasma leakage, shock and hemorrhagic manifestations. Currently, there are no vaccines available against dengue virus, although several tetravalent live-attenuated dengue vaccines are in ... years as a result of the expansion of the Aedes aegypti mosquito to dif- ferent geographic areas, and DHF has spread from South East Asia to the Western Pacific and the Americas. A substanti...

Ngày tải lên: 19/02/2014, 00:20

... linked to formation of an iron-peroxy adduct prone to fragmen- tation [266]. A similar p aradigm also appears to a pply to the final step in aromatase (CYP19)-catalyzed biotransforma- tion of androgens ... J.N., Corina, D. & Akhtar, M. (1996) The mechanism o f the a cyl-carbon bond cleavage re action catalyzed by recombinant sterol 1 4a- demethylase of Candida albicans. (other names...

Ngày tải lên: 19/02/2014, 16:20