Báo cáo khoa học: Mitochondrial biogenesis in mtDNA-depleted cells involves a Ca2+-dependent pathway and a reduced mitochondrial protein import pdf

... 5¢-GGCTGAGACAAGAA ACGCTGTAT-3¢, TBP sense 5¢-CCTCACAGGTCAAAG GTTTACAGTAC-3¢, antisense 5¢-GCTGAGGTTGCAG GAATTGAA-3¢). PCR amplifications were denaturation at 95°C for 15 s, annealing at 60°C for 1 min ... Ananadatheerthavarada HK, Vijayasarathy C, Shephard HM & Avadhani NG (2002) Mitochondrial stress-induced calcium signaling, phenotypic changes and invasive behavior in human lung ca...

Ngày tải lên: 23/03/2014, 15:21

... fat bodies were collected and RNA lev- els were analyzed using qPCR. Transcript abundance values for AaEcRA, AaEcRB, AaUSP -A, AaUSP-B, AaE7 5A (A) , AaHR3, AaHR4, AaE78, AaHR39, AaHR78 (B) and AabFTZ-F 1A, ... to increase again at peak vitellogenesis (18 + 24 h PBM). These transcripts (AaUSP -A, AabFTZ-F 1A , AabFTZ-F1B, AaHR78, AaHNF- 4A, AaHNF-4B, AaHNF-4C, AaSvp and AaERR) were...

Ngày tải lên: 18/02/2014, 13:20

... [6,7], resulting in a preference for binding to the DNA in the order AATT > TAAT ¼ TTAA ¼ ATAT > TATA [8]. For AATT tracts, binding of the drug can be divi- ded in two categories [9]. In class I ... structures containing Nt have been found in the NDB of which nine contain A and T bases in the central part of the DNA (seven contain an AATT tract and two contain a mi...

Ngày tải lên: 16/03/2014, 22:20

... (breast adenocarcinoma MCF-7 and SK-BR-3 cells, synovial sarcoma SW 982 cells and chondrosarcoma SW 1353 cells) than in normal mitochondria [185]; and in prostate and hepatocellular carcinoma, the ... stage and metastatic properties, some human tumors considered to be of fast growth are breast carcinoma, ovarian car- cinoma, melanoma, thyroid carcinoma, uterine carci- noma...

Ngày tải lên: 30/03/2014, 09:20

... There was a generalized decline in mitochondrial function that led to a decrease in total cellular heme and ATP pools. We also observed a decrease in mitochondrial heme aa 3 content and decreased ... mtTFA in PC12 cells and macrophages grown under normoxia and hypoxia by immunoblot analysis. Immunoblot analysis was carried out as described in Materials and meth...

Ngày tải lên: 20/02/2014, 23:20

... growth factor receptor (EGFR) is com- posed of an extracellular ligand-binding domain, a transmembrane domain and an intracellular tyrosine kinase domain. The binding of a ligand to the extracel- lular ... kinase by gefitinib. Gefitinib has been shown to inhibit cell survival and growth signaling path- ways such as the extracellular signal-regulated kinase 1 ⁄ 2 pathway and the Akt...

Ngày tải lên: 16/02/2014, 09:20

... N-terminus was obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and ... N-terminal hexahistidine tag was obtained by PCR using the pET2 1a ⁄ PNT- H6 plasmid [30] as the template. The forward primer (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was design...

Ngày tải lên: 18/02/2014, 04:20

... Tomita S, Ueno M, Sakamoto M, Kitahama Y, Ueki M, Maekawa N, Sakamoto H, Gassmann M, Kageyama R, Ueda N et al. (2003) Defective brain development in mice lacking the HIF-1alpha gene in neural cells. ... Wnt 7a and Wnt7b are expressed in ventral–lateral spinal cord, whereas Wnt1, Wnt3 and Wnt 3a are located in dorsal part of the spinal cord [40,42]. Neurogenic factors involved...

Ngày tải lên: 18/02/2014, 11:20

... VEGF-signaling pathway, or alternate VEGF family members. By contrast, a pathological increase in the blood supply in the CNS is seen in brain tumors, in particular malignant gliomas. In phase II clinical ... of vascular endothelial cells (ECs) in the BBB are well organized with claudins and ZO- proteins through a decrease in angiogenesis signaling and an increase in...

Ngày tải lên: 18/02/2014, 11:20

... Rosell A, Alvarez-Sabin J, Arenillas JF, Rovira A, Del- gado P, Fernandez-Cadenas I, Penalba A, Molina CA & Montaner J (2005) A matrix metalloproteinase pro- tein array reveals a strong relation ... minocycline can be easily used in humans. Taken together, the accumulating experimental and clinical data suggest that MMPs (and perhaps other extracellular proteases) may mediate...

Ngày tải lên: 18/02/2014, 11:20