Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx

Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx

Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx

... kDa, this indicates that CSB is a dimeric protein. DNA was not present in these fractions since the < /b> ATPase activity was only detectable after the < /b> addition of pUC19 DNA. This indicates that dimerization ... 4309 glutaraldehyde of the < /b> CSB dimer showed that CSB exists as a dimer in solution and indicated that the < /b> dimer forms in the < /b> absence of DNA a...
Ngày tải lên : 23/03/2014, 15:20
  • 9
  • 273
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2) SJS138 TACG AGATCT TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2) SJS172 GGGATCATGCCCA AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2) SJS173 AGTAAGGAAAATA AG...
Ngày tải lên : 16/02/2014, 09:20
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC SGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT SGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT ATH1_suc2 ... GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG R1_pLC1 TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC PEP4_D CAGAGAAAC...
Ngày tải lên : 18/02/2014, 06:20
  • 15
  • 475
  • 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... phosphatases sigma and delta. J Neurosci 26, 5872–5880. 35 Stoker AW, Gehrig B, Newton MR & Bay BH (1995) Comparative localisation of CRYP alpha, a CAM-like tyrosine phosphatase, and NgCAM in the < /b> ... ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2). A protein band of approximately 95 kDa is present exclusively in the <...
Ngày tải lên : 19/02/2014, 05:20
  • 14
  • 669
  • 0
Tài liệu Báo cáo khoa học: "The Contribution of Linguistic Features to Automatic Machine Translation Evaluation" docx

Tài liệu Báo cáo khoa học: "The Contribution of Linguistic Features to Automatic Machine Translation Evaluation" docx

... trained according to a specific automatic evaluation metric. Table 4 shows OST values obtained for the < /b> best metrics. In the < /b> table we have also included a ran- dom, a maximum (always pick the < /b> best ... since correla- tion cofficient against human judges do not reveal details about the < /b> advantages and disadvantages of particular metrics. We then use this approach t...
Ngày tải lên : 20/02/2014, 07:20
  • 9
  • 514
  • 0
Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt

Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt

... by using a Xcalibur BIOWORKS 1.0 software installed in the < /b> apparatus. Sequencing and quantitative analysis of the < /b> peptides Part of the < /b> reaction mixture described a bove was also applied t o an ... SulA3±169 was obtained from the < /b> MBP±SulA fusion protein by digestion with factor Xa. The < /b> protein was then puri®ed to apparent homogeneity by using a prep...
Ngày tải lên : 21/02/2014, 03:20
  • 7
  • 358
  • 0
Tài liệu Báo cáo khoa học: "The Structure of User-Adviser Dialogues: Is there Method in their Madness?" pdf

Tài liệu Báo cáo khoa học: "The Structure of User-Adviser Dialogues: Is there Method in their Madness?" pdf

... basis of an analysis of the < /b> task and an analysis of the < /b> users' and adviser's plans and goals. BOUNDARY MARKERS The < /b> analysis of boundary markers revealed reliable indicators at the < /b> opening ... of the < /b> task that the < /b> user is trying to accomplish and the < /b> user's goals and plans arising from the < /b> task; 2) the < /b> strat...
Ngày tải lên : 21/02/2014, 20:20
  • 7
  • 399
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... to the < /b> amyloid pathology of AD. Relative to the < /b> soluble Ab burden of the < /b> AD brain, a recent study described a mechanism by which decreased intracellular metal bioavailability may con- tribute ... brain [42,43], global AD research focused on this peptide as a causative agent in the < /b> disease. The < /b> 39–43 amino acid cleavage product of the < /b> Ab A4 prec...
Ngày tải lên : 07/03/2014, 10:20
  • 9
  • 634
  • 0
Báo cáo khoa học: The CssRS two-component regulatory system controls a general secretion stress response in Bacillus subtilis pdf

Báo cáo khoa học: The CssRS two-component regulatory system controls a general secretion stress response in Bacillus subtilis pdf

... medium and samples were taken at different intervals for absorbance readings at 600 nm and b- galactosidase activity determinations. To assay b- galactosidase activity, a semiautomated method was developed, ... folding catalysts at this subcellular location, protein misfolding and ⁄ or aggregation cannot always be prevented by the < /b> cell. These misfolded or aggrega- ted proteins ar...
Ngày tải lên : 07/03/2014, 12:20
  • 12
  • 428
  • 0
Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt

Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt

... mem- brane-order parameters [40]. GD3–R24 interactions with a protein may cause the < /b> lipid to be sorted on the < /b> basis of the < /b> characteristics of the < /b> protein, and such a mechanism is important for the < /b> trafficking ... it began to show a perinuclear distribution. After 30 min at 37 °C, the < /b> intracellular pool of R24 became more con- centrated in t...
Ngày tải lên : 16/03/2014, 13:20
  • 15
  • 329
  • 0
Từ khóa: