Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc

... and 3 Department of Analytical Chemistry, Faculty of Science, Palacky ´ University, Olomouc, Czech Republic; 4 Department of Analytical Chemistry, Faculty of Science, Masaryk University, Brno, Czech Republic; 5 Department ... evaluate the reactivity of the initial product aminoalde- hyde, the reaction was also carried out in the presence of 5m M ACA as a trapping nucleop...

Ngày tải lên: 19/02/2014, 16:20

... sequence and length of the helix between the two loops contain- ing the cleavage ⁄ ligation site, as well the size of the bulge, influence the exchange efficiency [16,32,33]. Therefore, the speci c ... Green circles indicate 5¢ -and3 ¢-terminal fluorescein moieties used for detection. Reaction was carried out in the absence and presence, respectively, of the oligonuc...

Ngày tải lên: 20/02/2014, 01:20

... according to a weighting scheme which takes into account the frequency information of the chunks and their collo- cations. More precisely, the weight of a chunk–pair– distance element cpd = (c i , ... dist i(i+2) ), etc. We do this for each chunk list computed for each web snippet. The distance dist ij of two chunks c i and c j is computed directly from the chunk list...

Ngày tải lên: 20/02/2014, 05:20

... C 1 C 2 = C −1 C 1 C −1 C 1 = Lexical-target Instances C 0 C n (n = −2 2) C 0 C −2 =, C 0 C −1 =, C 0 C 0 =, C 0 C 1 =, C 0 C 2 = C 0 C n C n+1 (n = −2 1) C 0 C −2 C −1 =, C 0 C −1 C 0 =, ... has comparable performance 898 Non-lexical-target Instances C n (n = −2 2) C −2 =, C −1 =, C 0 =, C 1 =, C 2 =...

Ngày tải lên: 08/03/2014, 01:20

... linguistic information reflects only the morpheme concatenation, as mentioned in the previous section. Especially, errors occur be- cause of the complex morphological characteris- tics of Korean. ... means the correction made directly by user. We can see that the rate of automatic correction increased, while that of manual correction de- Figure 4: Comparison between...

Ngày tải lên: 08/03/2014, 05:21

... dem- onstrated recently [23]. The extreme C- terminal ten residues are essential for the interaction of EcSSB with PriA helicase and the deletion of these residues affects the stimulation of helicase activity ... compared to that of the EcSSB C- terminal region. Comparison of localization of replication proteins between the active helical bacillary form and...

Ngày tải lên: 30/03/2014, 02:20

... of MDCK clones, cells were grown to con- fluence and the expression of glycolipids was analysed by immunocytochemistry and fluorescent confocal microscopy. MDCK cells ectopically expressing either Sial-T2 ... membrane of eukaryotic cells. They participate in cell surface events, such as the modulation of growth factor receptors and cell-to-cell and cell-to-matrix interaction...

Ngày tải lên: 16/03/2014, 04:20

... …8RIGSVKNTQKITEAMKLVAAAK-31 GGCCATATGCGGATCGGATCAGTCAAA ATTCCGGAC pET11-cDN12 …12VKNTQKITEAMKLVAAAK-31 TCGGCCATATGGTCAAAAACACGCAGAAG ACGGATCCA pET11-cDN16 …16QKITEAMKLVAAAK-31 TTGGCCATATGCAGAAGATCACCGAAGCA ATTAATCTC pET11-cDN20 ... Listed below are the amino-acid sequences and PCR primers of truncation mutants (D)ofthec subunit of spinach chloroplast ATP synthase. The numbers...

Ngày tải lên: 23/03/2014, 13:20

... blocks and the mechanism of iron coordina- tion [14,15]. This genomics-based characterization of natural products has been successfully applied in the discovery of the siderophores coelichelin and ... the discovery of orfamide A [17]. The accu- rate prediction of adenylation domain specificity was found to be crucial for successful mining and structural prediction an...

Ngày tải lên: 16/02/2014, 09:20

... [ 125 I]IGF- II in the presence of b-glucuronidase revealed that b-glucuronidase accelerated the rate of IGF-II uptake, suggesting that intermolecular cross-linking of recep- tors enhanced receptor endocytosis ... employing soluble forms of the receptor [25,26,34], indicates that the ectodomain of the receptor is capable of dimer forma- tion in the absence of ligand....

Ngày tải lên: 18/02/2014, 08:20