Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc
Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt
... and 3Department of Analytical Chemistry, Faculty of Science,Palacky´University, Olomouc, Czech Republic;4Department of Analytical Chemistry, Faculty of Science, Masaryk University, Brno,Czech Republic;5Department ... evaluate the reactivity of the initial product aminoalde-hyde, the reaction was also carried out in the presence of 5mMACA as a trapping nucleophilic reagent. Afterincubation at 30 C for a sufficiently ... in the presence of catalase (20 0 U) and 2.5 mMABA. After 1 h of incubation at 30 C, 1 mL of 15% trichloroacetic acid wasadded to the reaction mixture o f the total volume 5 mL; (b)Reaction...
- 13
- 604
- 0
Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt
... sequence and length of the helix between the two loops contain-ing the cleavage ⁄ ligation site, as well the size of the bulge, influence the exchange efficiency [16,32,33].Therefore, the speci c ... Green circles indicate 5¢ -and3 ¢-terminal fluorescein moieties used for detection. Reaction was carriedout in the absence and presence, respectively, of the oligonucleotide S6-anti, which is complementary ... defined changes in the nucleotide sequence and ⁄ or secondary structure of a speci c RNA areplanned on the basis of a preconceived idea. Thisrequires detailed structural and mechanistic informa-tion...
- 11
- 481
- 0
Tài liệu Báo cáo khoa học: "A Mobile Touchable Application for Online Topic Graph Extraction and Exploration of Web Content" ppt
... according toa weighting scheme which takes into account the frequency information of the chunks and their collo-cations. More precisely, the weight of a chunk–pair–distance element cpd = (c i, ... disti(i+2)), etc. We do this for each chunklist computed for each web snippet. The distancedistij of two chunks c i and c jis computed directlyfrom the chunk list, i.e., we do not count the position23 of ... hypothe-sis for web–based question answering.Finally, we compute the frequencies of eachchunk, each chunk pair, and each chunk pair dis-tance. The set of all these frequencies establishesthe...
- 6
- 458
- 0
Báo cáo khoa học: "A Cascaded Linear Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" pdf
... C 1 C 2= C −1 C 1 C −1 C 1=Lexical-target Instances C 0 C n(n = −2 2) C 0 C −2=, C 0 C −1=, C 0 C 0=, C 0 C 1=, C 0 C 2= C 0 C n C n+1(n = −2 1) C 0 C −2 C −1=, C 0 C −1 C 0=, ... has comparable performance898Non-lexical-target Instances C n(n = −2 2) C −2=, C −1=, C 0=, C 1=, C 2= C n C n+1(n = −2 1) C −2 C −1=, C −1 C 0=, C 0 C 1=, C 1 C 2= C −1 C 1 C −1 C 1=Lexical-target ... through the same approach.To facilitate tuning the weights, we use two com-ponents of the co-occurrence model Co(W, T ) torepresent the co-occurrence probability of W and T ,rather than use Co(W,...
- 8
- 445
- 0
Báo cáo khoa học: "Machine Aided Error-Correction Environment for Korean Morphological Analysis and Part-of-Speech Tagging" pptx
... linguistic information reflects only the morpheme concatenation, as mentioned in the previous section. Especially, errors occur be- cause of the complex morphological characteris- tics of Korean. ... means the correction made directly by user. We can see that the rate of automatic correction increased, while that of manual correction de- Figure 4: Comparison between automatic and manual correction ... Repeat steps 5 and 6 with automatic error correction using rules and correction logs so that incremental improvement of tagging accurarcy can be achieved. 8. Correct manually, if there is any...
- 5
- 306
- 0
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
... dem-onstrated recently [23]. The extreme C- terminal tenresidues are essential for the interaction of EcSSB withPriA helicase and the deletion of these residues affects the stimulation of helicase activity ... compared tothat of the EcSSB C- terminal region.Comparison of localization of replication proteinsbetween the active helical bacillary form and the dormant coccoid form of H. pyloriAs discussed earlier, ... antibioticresistance and recurrent infection following treatmentcomplicates the situation [3,4]. Considerable researchhas been conducted on the clinical aspects of H. pyloriinfection but the fundamental...
- 13
- 438
- 0
Báo cáo khoa học: Complex gangliosides are apically sorted in polarized MDCK cells and internalized by clathrin-independent endocytosis doc
... of MDCK clones, cells were grown to con-fluence and the expression of glycolipids was analysedby immunocytochemistry and fluorescent confocalmicroscopy. MDCK cells ectopically expressing eitherSial-T2 ... membrane of eukaryotic cells. They participate in cell surface events,such as the modulation of growth factor receptors and cell-to-cell and cell-to-matrix interactions [1–6]. The synthesis of gangliosides ... Inves-tigaciones Cientı´ficas y Te´cnicas (CONICET), AgenciaNacional de Promocio´n Cientı´fica y Tecnolo´gica and Ministerio de Ciencia y Tecnologı´a de la Provincia deCo´rdoba. The authors...
- 14
- 305
- 0
Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc
... …8RIGSVKNTQKITEAMKLVAAAK-31 GGCCATATGCGGATCGGATCAGTCAAA ATTCCGGACpET11-cDN12 …12VKNTQKITEAMKLVAAAK-31 TCGGCCATATGGTCAAAAACACGCAGAAG ACGGATCCApET11-cDN16 …16QKITEAMKLVAAAK-31 TTGGCCATATGCAGAAGATCACCGAAGCA ATTAATCTCpET11-cDN20 ... Listed below are the amino-acid sequences and PCR primers of truncationmutants (D)ofthec subunit of spinach chloroplast ATP synthase. The numbers in the plasmids indicate the numbers of residues ... filament, whichwas attached to the c subunit of the thermophilic bac-terial F1subcomplex, a3b3 c [9], e subunit F1[10,11] and CF1[12]. The catalytic core of the enzyme is a3b3 c, despite...
- 7
- 290
- 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... blocks and the mechanism of iron coordina-tion [14,15]. This genomics-based characterization of natural products has been successfully applied in the discovery of the siderophores coelichelin and ... the discovery of orfamide A [17]. The accu-rate prediction of adenylation domain specificity wasfound to be crucial for successful mining and structuralprediction and is the basis of the methodology ... consists of l-hOrn, l-Ser and two building blocks analogous to l-Arg.etcAetcBetcCetcDetcEetcFetcGetcHetcIetcJetcKTransporterNRPSMonooxygenaseRegulatory proteins1 kbCA1 C TCA4T E C...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: High-affinity ligand binding by wild-type/mutant heteromeric complexes of the mannose pptx
... [125I]IGF-II in the presence of b-glucuronidase revealed thatb-glucuronidase accelerated the rate of IGF-II uptake,suggesting that intermolecular cross-linking of recep-tors enhanced receptor endocytosis ... employing solubleforms of the receptor [25,26,34], indicates that the ectodomain of the receptor is capable of dimer forma-tion in the absence of ligand.Affinity cross-linking of [125I]IGF-II to ... ligand, collected by centrifuga-tion, and counted in a c- counter. Speci c [125I]IGF-II bind-ing was determined by subtracting c. p.m. ligand boundin replicate reactions carried out in the...
- 15
- 486
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015