Báo cáo khoa học: Physicochemical characterization of carbox

Báo cáo khoa học: Physicochemical characterization of carboxymethyl lipid A derivatives in relation to biological activity docx

... test Endotoxin activity of the lipid A analogs was determined by a quantitative kinetic assay based on the reactivity of Gram-negative endotoxin with Limulus amebocyte lysate (LAL) at 37 °C, using ... FEBS Physicochemical characterization of carboxymethyl lipid A derivatives in relation to biological activity Ulrich Seydel 1 , Andra B. Schromm 1 , Lore Brad...

Ngày tải lên : 23/03/2014, 13:20

14
392
0

Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx

... partner for binding to ligand as well as for transactivation of reporter genes in cells. An EcR gene switch that includes a fusion protein containing VP16 activation domain, GAL4 DNA binding ... proteins upon addition of ligand. The placement of EcR relat- ive to GAL4 and VP16 probably in uence the behavior of fusion protein upon binding to ligand. Apparently, having acti...

Ngày tải lên : 16/03/2014, 12:20

14
323
0

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... i.e. agonistically as well as antagonistically, completely inactive. The lack of antagonistic activity may be explained by the fact that this lipid A does not intercalate into target cell membranes by ... L.,Matsuda,K.,Takagi,M.&Yamamoto,N.(1997) Detection of serum antibodies against phosphocholine-containing aminoglycoglycerolipid speciﬁc to Mycoplasma fermentans in HIV-1 i...

Ngày tải lên : 21/02/2014, 00:20

9
665
1

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... function ugcgucugaca UGUACAGCcccugccaaauuuuaauaggcaat AGUAAAUAaauaacgacaagaagcaaaugg At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4g36040 ... and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGAC...

Ngày tải lên : 18/02/2014, 06:20

15
586
0

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... enzymatic transformation revealed that Bxe _A2 876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bond cleavage to yield methylglyoxal and acetate. Kinetic characterization ... Biolabs (Beverly, MA, USA) and Fermentas International Inc. (Burlington, Canada). Cultivation Table S2 summarizes the different conditions in which the B. xenovorans strain was incu...

Ngày tải lên : 18/02/2014, 06:20

15
624
0

Tài liệu Báo cáo khoa học: Kinetic characterization of the ﬁrst step of the ribozyme-catalyzed trans excision-splicing reaction docx

... USA). Data were fit using the kaleidagraph curve-fitting program (Synergy Software, Reading, PA, USA). The final concentration of the radiolabeled substrate in all reactions is 1.3 nm. A typical ... occurs. The ‘catalytic power’ of an RNA-cleaving ribozyme can be estimated by comparing the observed rate constant of a catalyzed reaction with that of an equivalent uncatalyzed reactio...

Ngày tải lên : 18/02/2014, 18:20

13
761
0

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... GC, Katakura K, Tomita T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu ... degradation rate of GmHO-1, indi- cated in Table 4, is comparable to that of SynHO-1 in the presence of NADPH, FNR, and Fd, and also to that of rHO-1 in the presence of NADPH...

Ngày tải lên : 19/02/2014, 05:20

16
617
0

Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt

... This approach is clearly an approximation; according to this parameterization, the changes in heat capacity arise from binding- induced changes in the solvent polar and apolar ASA. To evaluate the ... and without the receptor N-domain using the vadar program [41]. The DC p was calculated using the following equa- tion: DC p ¼ 0:45DASA apolar À 0:26 ASA polar where DASA apolar and DASA...

Ngày tải lên : 19/02/2014, 05:20

11
549
0

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... Characterisation and mitochondrial localisa- tion of AUH, an AU-speciﬁc RNA-binding enoyl-CoA hydratase. Gene 228, 85–91. 17 Nakagawa J & Moroni C (1997) A 20-amino-acid autonomous RNA-binding ... AUH in brain has a molecular weight of 32 kDa (AUHp32) [15]. For the kinetic characterization of AUH described in the work at hand, AUH was overproduced in Escherichia coli as...

Ngày tải lên : 19/02/2014, 07:20

11
625
0

Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc

... chromosome was ampliﬁed by PCR using chromosomal B. subtilis DNA as template and the oligonucleotides 5¢-TTGGTG GGATCCGTGACTCG AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTT GTCG ACTTATCGCACACTATAGCTTGATG-3¢ as primers (restriction ... currently avail- able antibiotics. Most notably, many strains are multidrug resistant, and the rapidly spreading resistance against vancomycin and methicillin constitutes...

Ngày tải lên : 19/02/2014, 13:20

12
692
0