0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

... gagt … ccac ag GGATGT 1.43105 a TAACAG gt aata … ttcc ag ACGTAT 6.54 250 TATCTG gt atgt … taac ag GATATG 0.895120 ACGGAG gt aaaa … tccc ag CAACTC 1.76138 GTTTTG gt aaga … attt ag GGCAGT 0.527117 ... 7.74262 a TACTTG gt atgt … aatc ag GATATG 1.35120 a ACAGAG gt aaaa … tctc ag AAAATT 9.96 138 GCATTG gt aagg … attt ag GGCAGT 1.27117 CATTAT gt aagt … tttc ag GATATT 0.178160 TTGCAG gt ttgt ... … ttta ag GTTCAA 1.29182 ATGGAC gt atgt … cata ag ATGTCC 3.810 994AAGGAC gt aagt … ttaa ag GATTGC 0.7011176 AGAAGA gt aagt … ttgc ag CAATTT 5.412130 ATGTTG gt aagt … tttt ag GGCATA 6.31385...
  • 9
  • 470
  • 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... (M.G.F.). K .A. M is the recipi-ent of an Arthritis Investigator Award and the Donaldand Delia Baxter Foundation Young Career ScientistAward.References1 Lin WJ, Gary JD, Yang MC, Clarke S & HerschmanHR ... Purandare AV, Chen Z, Huynh T, Pang S, Geng J,Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar-aman L (2008) Pyrazole inhibitors of coactivator associ-ated arginine methyltransferase 1 (CARM1). ... transcription, protein and RNA subcellular localization, RNAsplicing, DNA damage repair, and signal transduction[2]. Nine PRMT family members have been clonedand characterized to date, with putative 10th and...
  • 13
  • 646
  • 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG5 1028 A. Ray et al. ... the SAF-1/MAZ/Pur-1family, is expressed during inflammationAlpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2and Bimal K. Ray11 Department of Veterinary Pathobiology, ... growth factor-induced cells as well of mRNAs isolated from severaldiseased tissues revealed abundant expression of SAF-3. The transactiva-tion potential of SAF-3 is much greater than that of...
  • 11
  • 439
  • 0
Báo cáo khoa học: BGN16.3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt

Báo cáo khoa học: BGN16.3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt

... b-1,6-glucan) and a loweractivity was measured towards yeast glucan (18% ofthe maximum activity) and laminarin (8% of maxi-mum) which are b-1,3-glucans with b-1,6-glycosidiclinkages at branches at ... I, Hermosa MR, Tejada M, Gomis MD,Mateos PF, Bridge PD, Monte E & Garcia-Acha I(1997) Physiological and biochemical characterization ofTrichoderma harzianum, a biological control agent ofsoilborne ... b-1,4 (GlcNAc) 0Nigeran a- 1,3: a- 1,4 (Glc) 0Soluble starch a- 1,4: a- 1,6 (Glc) 0ABFig. 2. Purification of BGN16.3. SDS ⁄ PAGE analysis (A) and activity staining by pustulan-agarose overlay (B)...
  • 8
  • 327
  • 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... primers:EcoRI-rO-MACS-U (5¢-GAATTCatgaaggttctcctccactg-3¢)and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... (forward), 5¢-caccattactctgtctcctc-3¢ (re-verse); KS 5¢-ccttctggggcactgagatg-3¢ (forward), 5¢-agaacgcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctgggaagcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ ... 1997(forward), 5¢-ggttaaacaccacagaggcc-3¢ (reverse); OCAM5¢-gagaagtggtgtcccctcaa-3¢ (forward), 5¢-cctccatcatcttgcttggt-3¢ (reverse); NCAM 5¢-cttcctgtgtcaagtggcag-3¢ (for-ward), 5¢-gttggcagtggcattcacga-3¢...
  • 10
  • 393
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23...
  • 9
  • 444
  • 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... acyl-CoA.We have isolated a thioesterase from Alcaligenesfaecalis ISH108 and demonstrated its application inchemoselective and racemization free deacylation ofthiol esters [17]. A. faecalis was ... in b-oxidation. They showed that oleate is mostly degraded via the classical, isomerase-dependentpathway in E. coli, but that a small amount of 2-trans-5-cis-tetradecadienoyl-CoA is diverted ... Coo-massie blue, 2-mercaptoethanol, etc. were purchased fromSigma-Aldrich, St Louis, MO, USA.Bacterial strainThe strain isolated from soil samples was identified as a bacterium, A. faecalis according...
  • 14
  • 513
  • 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

... Ras-related GTPase Gtr1, as a protein that interacts with Meh1. A clue that these proteins physically interactcame from the databases and we have demonstratedthis by coimmunoprecipitation assays. ... cellular damage that is observed in mammalian cells. Two explanations forthese results can be envisaged. First, a formal possibil-ity that our studies have not ruled out is that, in yeast,Ers1 and ... glycosylation mutants are sensitiveto aminoglycosides. Proc Natl Acad Sci USA 92, 1287–1291.13 Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL &Fink GR (1999) The Arabidopsis thaliana proton...
  • 15
  • 378
  • 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

... by preparative electrophoresis, we demon-strate that this soluble protein is glycine-aspartate-rich, that it is highly gly-cosylated, that its sugar moieties are acidic, and that it is able to ... were analyzed, similarly, to detect free mono-saccharides that could have contaminated the sample during dialysis. For comparison, the monosaccharide compositionof the nacre ASM was that described ... biomineraliza-tion. Nature 332 , 119–124.2 Sudo S, Fujikawa T, Nagakura T, Ohkubo T, Sakagu-chi K, Tanaka M, Nakashima K & Takahashi T (1997)Structure of mollusc shell framework proteins. Nature387,...
  • 14
  • 383
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...
  • 16
  • 646
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ