Báo cáo khoa học: Alternative substrates for wild-type and L109A E coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc
Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc
... Alternative substrates for wild-type and L10 9A
E. coli
CTP synthases
Kinetic evidence for a constricted ammonia tunnel
Faylene A. Lunn and Stephen L. Bearne
Department of Biochemistry and ... were
determined in triplicate and average values are reported.
The reported errors are standard deviations. Initial rate
kinetic data was fit to Eqn (1) by nonl...
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... the 15 residues are con-
served. In view of the structural similarities between
yeast and mammalian enolases and the high degree of
sequence conservation, we believe that the effects of
these ... dissociated. The identification of the cleavage sites
and spectral studies of enolase have revealed some of the structural differ-
ences between the dimeric and monomeric forms of this enzyme....
Báo cáo khoa học: The association of heavy and light chain variable domains in antibodies: implications for antigen specificity pot
... therefore has an effect on the overall conformation
of the binding site. In this article, we analyze the structure of the interface
between the heavy and light chain variable domains and show that ... hapten-like antigens from peptide and
protein antigens.
In summary, the results of the analysis described
here clearly indicate that there are at least two differ-
ent packing modes for...
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx
... Costa V (2000) Adaptive
response of the yeast Saccharomyces cerevisiae to reac-
tive oxygen species: defences, damage and death. Redox
Rep 5, 277–285.
25 Maris AF, Assumpcao AL, Bonatto D, Brendel ... solvent-
accessible. All of the other cysteine residues are either
buried in the skeletal structure or exposed to the inter-
nal catalytic chamber environment. Therefore, we
investigated wheth...
Báo cáo khoa học: Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity docx
... whereas
the G36 0A enzyme was about twofold more active than wild-type enzyme.
The elevated K
A
for GTP and reduced GTP activation of CTP synthesis of
the mutant enzymes are in agreement with a ... (Table 1) reflects the amino acid replacement
and not an artefact due to the presence of denatured
protein.
Kinetic constants of the glutaminase half-reaction
Except the R359P and...
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... trans-acting factor for the
ESE3 sequence [25] and presumably also for the ESE
sequence upstream of D4 [42]. It has been reported
that ESE3 and ESS3 regulate the efficiency of A7 utili-
zation by modulating ... the tat intron is regulated by the combi-
nation of the above ESS elements, with ESE elements
located in the third tat exon [25] as well as a purine
rich ESE sequence (ESE2)...
Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc
... P-protein. It was further substantiated by
analysis of an engineered alternative Arabidopsis
H-protein. Hence, several lines of independent experi-
mental evidence consistently demonstrated that
alternative ... kinetic parameters were calculated by nonlin-
ear regression analysis using the software package
graphpad prism (GraphPad Software, San Diego, CA,
USA). All kinetic data are me...
Báo cáo khoa học: "Alternative Approaches for Generating Bodies of Grammar Rules" docx
... the sizes of the
automata. The differences between MDI-based and
bigram-based automata are not as dramatic as in
the “One-Automaton” case (Table 1), but the former
again have consistently lower ... “Many-
Automata” case (where we learned two automata
for each POS) we used the same procedure as
for the “One-Automaton” case, but now for ev-
ery individual POS. Because of space constrain...
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf
... initiation factor 2a (eIF 2a) was
apparent after 16 h of stearate treatment, reached a
peak at 22 h, and declined thereafter. Concomitantly
with eIF 2a phosphorylation, dramatic elevations in the
expression ... was efficient in oleate-treated cells,
whereas stearate-treated cells contained fewer and
smaller lipid droplets after 24 h of treatment (Fig. 5A) .
Moreover, coadministration o...
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC
SGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT
SGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT
ATH1_suc2 ... sequence
F2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA
R1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAA...