Báo cáo khoa học: Alternative substrates for wild-type and L109A E coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc

Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc

Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc

... Alternative substrates for wild-type and L10 9A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel Faylene A. Lunn and Stephen L. Bearne Department of Biochemistry and ... were determined in triplicate and average values are reported. The reported errors are standard deviations. Initial rate kinetic data was fit to Eqn (1) by nonl...

Ngày tải lên: 23/03/2014, 13:20

9 405 0
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf

Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf

... the 15 residues are con- served. In view of the structural similarities between yeast and mammalian enolases and the high degree of sequence conservation, we believe that the effects of these ... dissociated. The identification of the cleavage sites and spectral studies of enolase have revealed some of the structural differ- ences between the dimeric and monomeric forms of this enzyme....

Ngày tải lên: 16/03/2014, 06:20

10 520 0
Báo cáo khoa học: The association of heavy and light chain variable domains in antibodies: implications for antigen specificity pot

Báo cáo khoa học: The association of heavy and light chain variable domains in antibodies: implications for antigen specificity pot

... therefore has an effect on the overall conformation of the binding site. In this article, we analyze the structure of the interface between the heavy and light chain variable domains and show that ... hapten-like antigens from peptide and protein antigens. In summary, the results of the analysis described here clearly indicate that there are at least two differ- ent packing modes for...

Ngày tải lên: 28/03/2014, 22:20

9 387 0
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

... Costa V (2000) Adaptive response of the yeast Saccharomyces cerevisiae to reac- tive oxygen species: defences, damage and death. Redox Rep 5, 277–285. 25 Maris AF, Assumpcao AL, Bonatto D, Brendel ... solvent- accessible. All of the other cysteine residues are either buried in the skeletal structure or exposed to the inter- nal catalytic chamber environment. Therefore, we investigated wheth...

Ngày tải lên: 23/03/2014, 07:20

14 364 0
Báo cáo khoa học: Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity docx

Báo cáo khoa học: Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity docx

... whereas the G36 0A enzyme was about twofold more active than wild-type enzyme. The elevated K A for GTP and reduced GTP activation of CTP synthesis of the mutant enzymes are in agreement with a ... (Table 1) reflects the amino acid replacement and not an artefact due to the presence of denatured protein. Kinetic constants of the glutaminase half-reaction Except the R359P and...

Ngày tải lên: 23/03/2014, 13:20

9 222 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... trans-acting factor for the ESE3 sequence [25] and presumably also for the ESE sequence upstream of D4 [42]. It has been reported that ESE3 and ESS3 regulate the efficiency of A7 utili- zation by modulating ... the tat intron is regulated by the combi- nation of the above ESS elements, with ESE elements located in the third tat exon [25] as well as a purine rich ESE sequence (ESE2)...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc

Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc

... P-protein. It was further substantiated by analysis of an engineered alternative Arabidopsis H-protein. Hence, several lines of independent experi- mental evidence consistently demonstrated that alternative ... kinetic parameters were calculated by nonlin- ear regression analysis using the software package graphpad prism (GraphPad Software, San Diego, CA, USA). All kinetic data are me...

Ngày tải lên: 23/03/2014, 04:20

7 394 0
Báo cáo khoa học: "Alternative Approaches for Generating Bodies of Grammar Rules" docx

Báo cáo khoa học: "Alternative Approaches for Generating Bodies of Grammar Rules" docx

... the sizes of the automata. The differences between MDI-based and bigram-based automata are not as dramatic as in the “One-Automaton” case (Table 1), but the former again have consistently lower ... “Many- Automata” case (where we learned two automata for each POS) we used the same procedure as for the “One-Automaton” case, but now for ev- ery individual POS. Because of space constrain...

Ngày tải lên: 23/03/2014, 19:20

8 285 0
Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

Tài liệu Báo cáo khoa học: Interruption of triacylglycerol synthesis in the endoplasmic reticulum is the initiating event for saturated fatty acid-induced lipotoxicity in liver cells pdf

... initiation factor 2a (eIF 2a) was apparent after 16 h of stearate treatment, reached a peak at 22 h, and declined thereafter. Concomitantly with eIF 2a phosphorylation, dramatic elevations in the expression ... was efficient in oleate-treated cells, whereas stearate-treated cells contained fewer and smaller lipid droplets after 24 h of treatment (Fig. 5A) . Moreover, coadministration o...

Ngày tải lên: 14/02/2014, 22:20

12 722 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC SGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT SGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT ATH1_suc2 ... sequence F2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA R1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAA...

Ngày tải lên: 18/02/2014, 06:20

15 475 0
w