Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

... Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX Catherine Strassel, Sylvie Moog, Marie-Jeanne Baas, Jean-Pierre Cazenave and Franc¸ois Lanza INSERM ... have been proposed for glycoprotein (GP) V . It could act as a negative regulator of thrombin activation [6], or as an a ccessory receptor for c...

Ngày tải lên: 23/03/2014, 13:20

... for their increa sed V max value also showed an increase in their K m value. The increased K m values of the mutant constructs may be caused predominantly by an increased off-rate for dissociation ... reaction velocity was increased (via accelerated product release, as described earlier). For the practical purpose of improving the produc- tivity of a riboflavin-overproducing stra...

Ngày tải lên: 18/02/2014, 11:20

... for d etection of the mutations are underlined. Designation Endonuclease Sequence A- 1 5¢ ataatagaattcattaaagaggagaaattaactatgttcagtggtattaaaggccctaac 3¢ A- 2 5¢ tattatggatccttaatacaaagctttcaatcccatctc ... tattatggatccttaatacaaagctttcaatcccatctc 3¢ W27G SacII 5¢ aaaggccctaacccttcagacttaaagggaccagaattgcgcattcttattgtccatgc ccgcggtaatcttcaag 3¢ W27I AseI5¢ aaaggccctaacccttcagacttaaagggaccaga...

Ngày tải lên: 08/03/2014, 10:20

... drug was aborted in the 1980s, but recent work has shown activity against various Plasmodium spp., including Plasmodium fal- ciparum, a major human pathogen [17,20–22]. These studies have validated ... near- permanent basis. The residual enzyme activity after 24 h of incubation was measured after massive dilution of an aliquot of the reaction mixture, using 1 as substrate. The dec...

Ngày tải lên: 16/03/2014, 06:20

... tuberculosis and Mycobacterium leprae as well as in the v arious Plasmodium species causing malaria. Recent studies have already shown that malaria can be treated by the antibiotic fosmidomycin, an inhibitor ... Sequence (5¢-3¢) IspDF Forward ACG CATATGAGTGAAATGAGCCTT ATTATGTTA IspDF Reverse GCT GGATCCTCATAATCTTGTCCAAT CAAAATA Fig. 1. Deoxyxylulose phosphate pathway for the biosynthe...

Ngày tải lên: 23/03/2014, 13:20

... 5¢- GGAGAAATTAACCATGGTATTGATGGTAAATCTTGG-3¢ MJ-RibE-2 BamHI 5¢- TTCTTTGGAAGGGATCCAATTTCATAAAAATTT-3¢ MJ-RibE-3 EcoRI 5¢- ACACAGAATTCATTAAAGAGGAGAAATTAACTATG-3¢ BS-RibH-DN-G6 EcoRI, NcoI5¢- ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢ BS-RibH-2 ... NcoI5¢- ATAATAGAAGAATTCATTAAAGAGGAGAAATTAACCATGGGAAATTTAGTTGGTACAG-3¢ BS-RibH-2 BamHI 5¢- TATTATGGATTCTTATTCGAAAGAACGGTTTAAG-3¢ Fi...

Ngày tải lên: 23/03/2014, 21:20

... the incorporation of drugs into the inner leaflet of the plasma membrane and ⁄ or accelerate its lateral transport to the Pgp. Tran et al. [29] have analyzed the kinetic parameters of Pgp- mediated ... estimate Pgp activity. The capacity of the surface-active agents to accelerate passive drug trans- bilayer movement was not correlated with their fluidizing characteristics, measured...

Ngày tải lên: 30/03/2014, 04:20

... of Cg-emb in Corynebacterineae leads to a novel truncated cell wall arabinogalactan, whereas inactivation of Cg-ubiA results in an arabinan-deficient mutant with a cell wall galactan core. J Biol ... synthesis of d-arabinose, but rather inhibits the incorporation of d-arabinofurano- syl residues of decaprenyl-phospho-arabinose into the arabinogalactan and (lipo)arabinomanna...

Ngày tải lên: 30/03/2014, 04:20

... CagA-independent pathways involved in the activation of receptor and non-RTKs, pro -in ammatory signalling, Rho GTPase activation, scattering and motility of gastric epithelial cells, as well as ... factor -a or IL-8, have been associated with an increased risk of developing disease, including gastric cancer, as summarized in excellent review articles [1–3,5] (more detail...

Ngày tải lên: 14/02/2014, 19:20

... the in vitro activity of acyl-CoA:ergosterol acyltransferase was determined in an are1 deletion background. The enzyme activity in the ste20D strain and the cla4D strain was indistinguishable ... of SE in cla4D cells could be explained by a negative regulation of Are2p activity by Cla4p. Alternatively, Are2p activity may be normal in cells lacking CLA4, and increased amounts...

Ngày tải lên: 18/02/2014, 13:20