Báo cáo khoa học: Determination of the reopening temperature of a DNA hairpin structure in vitro pptx

... to detect the DNA hairpin reopening temperature. A single DNA hairpin structure was formed on the DNA template by thermal denaturation and renaturation, and this hairpin structure w as p redicted ... nearest-neighbour thermodynamics calculation, suggesting that it can be useful for evaluating the reopening temperature for a DNA hairpin in a local regio...

Ngày tải lên: 23/03/2014, 13:20

... GGTGCT gAGCTCAAGTGTGACTTtcGTCTAC SacI W402F CCGGTG GTcGAcTTTGGTTtcACGCCC SalI E273Q ACGTACTGCTgTCCGGAA AGtACtCCATGGCCGC ScaI D353N TCCAATCCGTtAGTC TGgCCaTAGAACGCGC MscI E356Q GGAGAAT GGTgCCAGGGTACATTTcCAATCCGTCA KpnI D372N ... N-terminal and b-he lical domains participate in binding of the polysaccharide, pullulan. Comparison of the active sites of the model of IPU and Dex4 9A...

Ngày tải lên: 19/02/2014, 16:20

... Evaluation of Association Measures 2.1 State -of- the- art A standard procedure for the evaluation of AMs is manual judgment of the -best candidates identi- fied in a particular corpus by the measure ... curves. The major drawback of an approach where all low-frequency candidates are excluded is that a large part of the data is lost for collocation extrac- tion. I...

Ngày tải lên: 20/02/2014, 18:20

... of the 3D structures of AC and AC–CaM, which are still not available, and labeling of the AC protein at other locations in its regulatory and catalytic domains using single-cysteine mutants are ... site in both the uncomplexed AC and the AC–CaM complex. Dynamics of the AC catalytic domain as probed by acrylodan Taking advantage of the absence of Cys residues in...

Ngày tải lên: 07/03/2014, 15:20

... Cys345 and the thiol form of bacitracin A. The thiol form of the thiazoline ring of bacitracin A and Cys345 are shown as chemical structures, the rest of bacitracin A as ‘Bacitracin A , and all other ... Separation of bacitracin analogs. (A) Structures of the most abundant bacitracin analogs of commercial bacitracin mixtures including the amino-thiazoline ring...

Ngày tải lên: 14/03/2014, 23:20

... coding linker containing a NotI site at the 5¢ end of the linker (5¢-GGC CGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAG GACCTGTAG-3¢) and noncoding linker containing an EcoRI site at the 5¢ end of the linker ... 5¢-CACCC AAGCTTGCCACCATGCAGGTTACTCT GAAAGAGTC-3¢; primer 4, 5¢-CACCC AAGCTTGCCACCATGAAATG CAGCTGGGTTATCTTC-3¢; primer 5, 5¢-CAGAACCACCACCCCCTG AGGAGACGGTGACTGAGGTTCC-3¢; primer 6, 5...

Ngày tải lên: 16/03/2014, 14:20

... cellular signaling pathways such as the MAPK cascade. The first kinase was activated by a receptor that switches slowly between an active and an inactive state. As the duration and amplitude of signaling ... FluorS TM MultiImager (Bio-Rad) and quantified using the multi- analist software (Bio-Rad). All measurements were carried out in the linear range of the method. The st...

Ngày tải lên: 16/03/2014, 18:20

... the hPAHÆadrenaline/ dopamine binary complex [17] was superimposed onto that of the ligand-free rPAH containing the regulatory and catalytic domains [19] the catecholamine main-chain is also Fig. ... by several mechanisms in order to maintain the phenylalanine and tyrosine homeostasis in vivo despite great fluctuations in the dietary intake of L-Phe and the overall rate...

Ngày tải lên: 17/03/2014, 09:20

... curcumin increased the accumulation of Mad2 and BubR1 at the kinetochores, indi- cating that it activated the mitotic checkpoint. In addition, curcumin treat- ment increased the metaphase ⁄ anaphase ratio, indicating ... Bioengineering, Indian Institute of Technology Bombay, Mumbai, India Introduction Curcumin, a natural product found in the rhizome of Curcuma longa, is...

Ngày tải lên: 23/03/2014, 03:20

... MJ, Padmakumar R & Hausinger RP (1999) Stopped-flow kinetic analysis of Escherichia coli tau- rine ⁄ alpha-ketoglutarate dioxygenase: interactions with alpha-ketoglutarate, taurine, and oxygen. ... mechanism of HIF regulation, asparaginyl hydroxylation (Asn803) in the HIF -a C-terminal transactivation domain reduces the interaction of HIF with transcriptional coactivators [8]....

Ngày tải lên: 23/03/2014, 03:20