Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx
... kept at 4 °C and used within 10 days.Quantification of alkaline phosphatase and aminopeptidase activitiesSpecific alkaline phosphatase (ALP) and N-aminopeptidase(APN) enzymatic activities of BBMV ... Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae Juan L. Jurat-Fuentes1 and Michael J. Adang1,2Departments of 1Entomology ... a membrane-bound form of alkaline phosphatase we termHvALP (H. virescens alkaline phosphatase) . As observed in other insect alkaline phosphatases, HvALP was GPI-anchored to the cell membrane. In insect...
- 9
- 399
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... Miyamoto K, Tanaka K, Kawai M, TainakaK, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encodinggene from the marine bacterium Alteromonas sp. strainO-7. ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream ... microtiter plate protocol as described bythe manufacturer using BSA as standard.Standard enzyme assaySPRK activity was routinely measured using Suc-Ala-Ala-Pro-Phe-pNA (Sigma Aldrich) as substrate....
- 14
- 523
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site.The ... purification of recombinant ASP3c. (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichiapastoris. Lane 1 shows standards (Low range and Polypeptide kits,Bio-Rad, France) and lanes 2–5 are 50-lL ... ligand binding activity of ASP3c was furtherinvestigated using displacement of ASA, a fatty acid probewith an anthroyloxy fluorophore. Anthroyloxy derivativesemission maxima are only weakly affected...
- 11
- 642
- 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx
... TittmannK (2005) Intermediates and transition states in thiamindiphosphate-dependent decarboxylases. A kinetic and NMR study on wild-type indolepyruvate decarboxylase and variants using indolepyruvate, ... in vivo role in phenylalanine and tryptophancatabolism [2]. It may also be involved in tyrosinemetabolism but, when alternative pathways are avail-able, it is unlikely to play any significant ... sequence,confirming that the N-terminal Met and Ala wereindeed absent. Although cleavage of the terminal Metwas not unexpected, the loss of the alanine residue wasinitially surprising. However, the literature...
- 12
- 436
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 ...
- 12
- 772
- 0
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt
... amino acid sequence of hemerythrin fromSiphonosoma cumanense. Protein Seq Data Anal 3,141–147.43 Yano H, Satake K, Ueno Y & Tsugita A (1991) Theamino acid sequence of the beta chain of ... (http://www.fruitfly.org/seq_tools/promoter.html) and has a probability of 0.98 (indicated by a redarrow in A) . Enlarged (T) indicates possible transcription start. Putativeribosomal binding site is enlarged in bold. The predicted terminationloop ... involved as iron ligands are indicated by (#). (*) indicates thefive hydrophobic pocket-forming amino acids. Characterization of prokaryotic haemerythrin O. A. Karlsen et al.2432 FEBS Journal...
- 13
- 501
- 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt
... The radioactivity wascounted on a gamma counter (Riastar, Packard Instrument,USA), and each point was the mean of triplicates. Bindingdata were analyzed using the RADLIG 4 software (BIO-SOFT, ... genetic ability to thrive on pea seeds and resist the toxic activity of pea albumin PA1b: five susceptible strains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamaisLS, and S. granarius BrayardÕ and ... (Ki) and maximal binding capacity (Bmax)ofPA1bondifferent species and strains of insects measured by competitive inhibition of the125I-labelled PA1b binding.Insects species and strainsKi±...
- 7
- 604
- 0
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx
... of trophic and toxic interactionsinvolving insects, comparative structural and func-tional data on insect aminopeptidases are lacking. In aphids, APN occurs in the apical network of lamellae, ... by fitting data by a weighted linear regression usingthe software SigmaPlotÒ. AlabNA,L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, L-arginine-p-nitroanilide; MetbNA,L-methionine-b-naphthylamide; ... cDNA library. The complete sequence of APNhas standard residues involved in zinc co-ordination and catalysis and a glycosyl-phosphatidylinositol anchor, as in APNs from Lepidoptera. APNhas a...
- 15
- 391
- 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx
... 2387 Characterization of a novel long-chain acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial ... theabnormal accumulation of intracellular acyl-CoA.We have isolated a thioesterase from Alcaligenesfaecalis ISH108 and demonstrated its application in chemoselective and racemization free deacylation ... diethylpyrocarbonate.Alcaligenes thioesterase was active in and stable to a wide range of temperatures and pH values. Maximumactivity was observed at 65 °C and pH 10.5 and variedbetween 60% and 80% at 25–70 °C and pH 6.5–10(Figs...
- 14
- 513
- 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc
... 5’-TGCCCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletionCAT1 5’-CGCGGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacementCAT2 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ XbaI stkP replacementPRTI 5’-CAATTGACCAGCCTTGAGCA-3’ ... expressionUFKFP 5’-CGCGAATTCCGCAAGATATCGGATTAGGAA-3’ EcoRI stkP deletionUFKRP 5’-CGCGGATCCCTTGCCGATTTGGATCATTC-3’ BamHI stkP deletionDFKFP 5’-GCTCTAGAATCTACAAACCTAAAACAAC-3’ XbaI stkP deletionDFKRP ... 2 and 6) and membrane fraction (3 and 7) of S. pneumoniae strains. Purified recombinant StkP was used as a control (lane 4). Arrows indicate bands corresponding to StkP. Molecular mass standards...
- 12
- 466
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ