Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... kept at 4 °C and used within 10 days. Quantification of alkaline phosphatase and aminopeptidase activities Specific alkaline phosphatase (ALP) and N-aminopeptidase (APN) enzymatic activities of BBMV ... Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae Juan L. Jurat-Fuentes 1 and Micha...

Ngày tải lên: 23/03/2014, 13:20

9 400 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... Miyamoto K, Tanaka K, Kawai M, Tainaka K, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encoding gene from the marine bacterium Alteromonas sp. strain O-7. ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... with M. brassicae CSPMbraA6 [32]. We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site. The ... purification of recombinant ASP3c. (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichia pastoris. Lane 1 shows standards (Low range and Polypeptide kits, Bio-Rad, France) a...

Ngày tải lên: 21/02/2014, 03:20

11 642 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Tittmann K (2005) Intermediates and transition states in thiamin diphosphate-dependent decarboxylases. A kinetic and NMR study on wild-type indolepyruvate decarboxylase and variants using indolepyruvate, ... in vivo role in phenylalanine and tryptophan catabolism [2]. It may also be involved in tyrosine metabolism but, when alternative pathways are avail- able, it is unlikel...

Ngày tải lên: 06/03/2014, 00:21

12 436 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3, 141–147. 43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain of ... (http://www.fruitfly.org/seq_tools/ promoter.html) and has a probability of 0.98 (indicated by a red arrow in A) . Enlarged (T) indicates possible transcription start. Putative rib...

Ngày tải lên: 07/03/2014, 17:20

13 501 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... The radioactivity was counted on a gamma counter (Riastar, Packard Instrument, USA), and each point was the mean of triplicates. Binding data were analyzed using the RADLIG 4 software (BIO- SOFT, ... genetic ability to thrive on pea seeds and resist the toxic activity of pea albumin PA1b: five susceptible strains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamais LS, and S. granar...

Ngày tải lên: 08/03/2014, 02:21

7 605 0
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... of trophic and toxic interactions involving insects, comparative structural and func- tional data on insect aminopeptidases are lacking. In aphids, APN occurs in the apical network of lamellae, ... by fitting data by a weighted linear regression using the software SigmaPlotÒ. AlabNA, L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, L-arginine-p-nitroanilide; M...

Ngày tải lên: 16/03/2014, 12:20

15 392 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... 2387 Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis Puja Shahi* † , Ish Kumar* ‡ , Ritu Sharma, Shefali Sanger and Ravinder S. Jolly Institute of Microbial ... the abnormal accumulation of intracellular acyl-CoA. We have isolated a thioesterase from Alcaligenes faecalis ISH108 and demonstrated its application in chemoselective and ra...

Ngày tải lên: 16/03/2014, 13:20

14 513 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

... 5’-TGC CCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletion CAT1 5’-CGC GGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacement CAT2 5’-GC TCTAGAAAGTACAGTCGGCATTAT-3’ XbaI stkP replacement PRTI 5’-CAATTGACCAGCCTTGAGCA-3’ ... expression UFKFP 5’-CGC GAATTCCGCAAGATATCGGATTAGGAA-3’ EcoRI stkP deletion UFKRP 5’-CGC GGATCCCTTGCCGATTTGGATCATTC-3’ BamHI stkP deletion DFKFP 5’-GC TCTAGAATCTACAAACCTAAAACA...

Ngày tải lên: 16/03/2014, 18:20

12 466 0
w