Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx
... Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide Johannes Oehlke 1 , Gerd Wallukat 2 , Yvonne ... form appearing in both cases at Table 1. Sequences of the PNA derivatives studied. Compound Sequence MAP KLALKLALKALKAALKLA-NH 2 I Fluos-GGAGCAGGAAAG-Lys (antisense) II...
Ngày tải lên: 23/03/2014, 13:20
... GCCATGCTAGCAATCATCACCGTAG CHH-LR GTTGAGATCTGTTGTTTACTTCTTC 423 MIH-LF GAGTTATCAACGACGAGTGTCC MIH-LR GAGACGACAAGGCTCAGTCC 249 AK-LF AAAGGTTTCCTCCACCCTGT AK-LR ACTTCCTCGAGCTTGTCACG 450 CHH-SF GACTTGGAGCACGTGTGT CHH-SR ... GACTTGGAGCACGTGTGT CHH-SR TATTGGTCAAACTCGTCCAT 143 MIH-SF AAGACAGGAATGGCGAGT MIH-SR AATCTCTCAGCTCTTCGGGAC 100 AK-SF AAACGGTCACCCTCCTTGA AK-SR ACTTCCTCGAGCTTGTCACG 132 3282 J....
Ngày tải lên: 21/02/2014, 00:20
... b-1,6-GlcNAc branched tri-antennary and tetra-antennary oligosac- charides in a 5 b 1 [56]. Similarly, characterization of the carbohydrate moieties in a 3 b 1 from nonmetastatic and metastatic human melanoma cell ... M, Yamaguchi N, Kangawa K & Taniguchi N (1993) Purification and characterization of UDP-N-acetylglucosamine: alpha-6- D-mannoside beta 1-6N-acetylglucosaminyltr...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... 7.0) at a concentration of 0.5 mgÆmL )1 . Spec- tra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 nmÆmin )1 . Steady-state tryptophan fluorescence measurements Measurements ... Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl 2 , NaCl and mineral oil were obtained from Sigma (St...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: "What lies beneath: Semantic and syntactic analysis of manually reconstructed spontaneous speech" pdf
... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 746–754, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP What lies beneath: Semantic and syntactic analysis of ... utter- ances (about 72% of the annotated SSR data) can be given a semantic analysis in the following sec- tions. For each well-formed and grammatical sen- tence,...
Ngày tải lên: 20/02/2014, 07:20
Tài liệu Báo cáo khoa học: "Prosodic Aids to Syntactic and Semantic Analysis of Spoken English" ppt
... the range of syntactic pos- sibilities and the parser will align tone group and move syntactic boundaries at a later stage. By integrating syntax and semantics, the Parser is capable of resolving ... "now" as a cue word rather than as an adverb. 7. DISCUSSION We have shown that by integrating prosody with syntax and semantics in a natural language parser...
Ngày tải lên: 20/02/2014, 21:20
Báo cáo khoa học: Regulated expression by PPARa and unique localization of 17b-hydroxysteroid dehydrogenase type 11 protein in mouse intestine and liver pdf
... one containing a PPARa ligand, Wy-14 643 (–), were separated by SDS ⁄ PAGE and analyzed by western blot- ting. After analysis, the transferred membrane was stained with Coomassie Brilliant Blue ... 3,17-androstanediol and abundant expression in steroidogenic tissues such as placenta and gonads have been described [7]. 17b-HSD11 also has a protein domain of glucose ⁄ ribitol de...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... CAF-1 – a molecular link between recombination and chromatin assembly during meiosis Satomi Ishii* , †, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata, Kengo Sakaguchi and ... 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT. CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG. To over- express N-termina...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt
... membrane, whereas PilW, PilQ and PilA4 are located in the inner and outer membranes. These data show that PilMNOWQ and PilA4 are components of a DNA translocator structure that spans the inner and outer ... proteins PilMNOWQ and PilA4, and demonstrate that the pilMNOWQ genes are each essential for natural transformation. We identified three different forms of PilA4, one with...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Local stability identification and the role of key acidic amino acid residues in staphylococcal nuclease unfolding ppt
... m NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL )1 . Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 nmÆmin )1 . Steady-state ... University of Minnesota College of Biological Sciences, St. Paul, MN, USA Staphylococcal nuclease (SNase) is a globular protein that consists of 149 amino acids...
Ngày tải lên: 07/03/2014, 21:20