Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel speciﬁcity towards C-terminal glutamate residues pptx

... 2011 Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel speciﬁcity towards C-terminal glutamate residues David P. Bown and John ... was assayed, there was a qualitative correlationbetween the appearance of the putative 36 kDa activated carboxypeptidase polypeptide, and the level of activityÓ FEBS 2004 Glutamate- speciﬁc insect ... and characterization of carboxypeptidases from H. armigeralarval gut extractGut extract was prepared from fourth instar lavae of H. armigera as described previously [10]. Extract from 65larvae...

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... as a template. The quality of the model was ﬁrst assessed usingprocheck [32,33]. The vast majority of residues (89.7%) fallinto the most favoured regions of the Ramachandran plot,9.4% in the ... The amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3,141–147.43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain ... to the predicted length of the MCA0715 transcript. The molecular sizesare indicated as given by the Invitrogen 0.24–9.5 kb RNA ladder.O. A. Karlsen et al. Characterization of prokaryotic haemerythrinFEBS...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... W81, as observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand ... nativesignal peptide was ampliﬁed by PCR using the followingprimers: 5¢ primer, 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak ... iscleaved after translation. The average molar mass calculatedfor the mature protein, assuming the formation of twodisulﬁde bridges, was 12 756.6 Da, in agreement with the measured molar mass...

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... alternative pathways are avail-able, it is unlikely to play any signiﬁcant role in the catabolism of the branched-chain amino acids or of methionine.Identiﬁcation and mutation of residues affectingsubstrate ... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependentphenylpyruvate decarboxylase from Saccharomyces cerevisiaeMalea M. Kneen1, Razvan Stan1, Alejandra Yep2, ... in Table 2, conﬁrm that allthree residues are important for catalysis by ScPPDC. The kcatvalue for reaction of each variant with PPA islower than that of the wild-type enzyme and, with the exception...

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 ...

Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... it was named PA1b for pea albumin 1b.PA1b is the result of the post-translational cleavage of the albumin proprotein PA1, also releasing a second peptide(PA 1a) . PA1b consists of 37 amino acids, ... tubes. The radioactivity wascounted on a gamma counter (Riastar, Packard Instrument,USA), and each point was the mean of triplicates. Bindingdata were analyzed using the RADLIG 4 software (BIO-SOFT, ... strains. Surprisingly, the microsomal fraction of anextract of the resistant insect D. melanogaster also displayed a strong binding capacity. The determination of the characteristics of the...

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase puriﬁed from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... APN2AAD31184 Ldi APN2BAA32140 Bmo P91885 Mse APN2CAA10950 PxyBAA33715 BmoAAX39866 Tni APN4AAK69605 SliAAF37559 Hpu APN2AAK58066 HviAAC36148 PinAAX39865 Tni APN3AAF01259 Pxy APN3Q11000 ... orderLepidoptera to be fully characterized and sequenced.0.1AAB70755 PxyAAX39863 Tni APN1AAF08254 HviAAN75693 Har APN1AAF37558 Hpu APN1AAC33301 Bmo Q11001 Mse A pisum APNCAA66467 PxyAAX39864 Tni APN2AAD31184 ... ﬁtting data by a weighted linear regression using the software SigmaPlotÒ. AlabNA,L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, L-arginine-p-nitroanilide; MetbNA,L-methionine-b-naphthylamide;...

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... 2387 Characterization of a novel long-chain acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial ... prevent the abnormal accumulation of intracellular acyl-CoA.We have isolated a thioesterase from Alcaligenesfaecalis ISH108 and demonstrated its application inchemoselective and racemization ... which the addition of substrate was omitted. The sample was incubatedfor 5 min, and a 5-lL aliquot of each sample waswithdrawn and assayed for activity by the DTNBmethod using stearoyl-CoA as...

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identiﬁcation of kinase substrates doc

... 5’-GCTCTAGAATCTACAAACCTAAAACAAC-3’ XbaI stkP deletionDFKRP 5’-TGCCCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletionCAT1 5’-CGCGGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacementCAT2 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ ... PurposeSTKP-F 5’-AGGATGCCATATGATCCAAATCGGCAA-3’ NdeI stkP expressionSTKP-R 5’-TTGATTATGAATTCGCTTTTAAGGAGTAGC-3’ EcoRI stkP expressionSTKP-RT 5’-GTAGGACAGAATTCAAGACAAGTCTACATACA-3’ EcoRI stkP expressionSMUT ... absent inmutant strain was identiﬁed as a- subunit of RNA-polymerase (RNAP). Transcriptional activator proteinsin bacteria often operate by interaction with the C-ter-minal domain of the a- subunit...

Xem thêm