Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot
Tài liệu Báo cáo khoa học: "Sentence Disambiguation by a Shift-Reduce Parsing Technique" pot
... The anss~er is equivocal. Although the implementation acts as a simulator for a nondeterministic machine, the nondeterminism is a priori bounded, given a particular grammar and lexicon. 3 ... take a nondeterministic grammar specification and im- pose arbitrary constraints to convert it to a deter- ministic specification {unless, of course, there is a general rule wh...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
... 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC ... TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC 2579 TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTA...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Protein–protein interactions and selection: generation of molecule-binding proteins on the basis of tertiary structural information potx
... tertiary structures of donor and recipient proteins in detail. In particular, visualization facilitates the identification of fragments with binding ability. The RGD motif (Arg-Gly-Asp) is a well- known ... protein–protein interac- tions, and the information might suggest novel designs for high-quality artificial libraries. Construction of high-affinity-binding proteins by multispecific...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc
... CCCCGTGTTAGGATTGGGT TaqMan-Le18s-140 AAGGCAGCAGGCGCGCAAA Psy1 Psy1F312 TGACGTCTCAAATGGGACAAGT EF534739 69 RT-PCR Psy1R381 CCTCGATGAATCAAAAAAACGG TaqManPsy1 TCATGGAATCAGTCCGGGAGGGAA Psy2 Psy2F952 AGGCAAGGCTGGAAGATATTTTT EF534738 ... Sci USA 87, 9975–9979. 12 Dogbo O, Laferriere A, d’Harlingue A & Camara B (1988) Carotenoid biosynthesis: isolation and character- ization of a bifunction...
Ngày tải lên: 07/03/2014, 05:20
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
... calculated ones are not significant. We believe therefore that for this reaction the traditional mechanism of isotopic exchange, involving the formation of a quinonoid species as a principal intermediate structure, ... side chain is the main factor controlling K i . Amino acids that contain nucleophilic side chains ( L -aspartic acid, L -homo- serine, L -methionine, L -glutamic aci...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... the adaptation to multiple envi- ronmental stresses [3,4]. There is now an accumulation of data that shows Hfq is an RNA- binding protein that is associated with RNA replication, translation and ... the idea that stimulation of polyadenylation reflects the affinity of Hfq for the RNA rather than its interaction with PAP I. Alternat- ively, it is also possible that PAP I stimul...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... used: anti-ADAM10, a polyclonal rabbit antibody against endogenous ADAM10 and anti-TACE, and a polyclonal rabbit antibody against endogenous TACE (Chemikon International, Temecula, CA). Both antibodies ... depends on each ones exact cellular localization. As intracellular trafficking is regulated by their cytosolic domains, which contain different sorting motifs, it is possible tha...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx
... 5. A grammar is one-step special- ized from a grammar , , if and , s.t. , and iff . A grammar is specialized from a grammar , , if it is obtained from in -specialization steps: , where is fi- nite. ... specialization steps Rule generalization steps Figure 2: Example of a simple grammar lattice. All grammars generate , and only generates ( is a common lexicon for all the...
Ngày tải lên: 08/03/2014, 02:21
![Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot](https://media.store123doc.com/images/document/14/rc/ld/medium_ldo1394248806.jpg)
Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot
... formation of DE2 is caused, a t least partially, by a lipid-induced conformational change. This change mediates more favourable active site spatial coordinates responsible for t he binding and ... quantitated by measuring the 14 C-radio- activity of the fractions by liquid scintillation counting using [ 14 C]-Ole 2 PtdCho as marker. The final vesicular preparations are characteri...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Crystal structure of a glycoside hydrolase family 6 enzyme, CcCel6C, a cellulase constitutively produced by Coprinopsis cinerea pot
... Kiyohiko Igarashi 3 , Masahiro Samejima 3 , Kiyoharu Fukuda 1 , Atsushi Nishikawa 2 and Takashi Tonozuka 2 1 Department of Environmental and Natural Resource Science, Tokyo University of Agriculture ... level. This supplementary material can be found in the online version of this article. Please note: As a service to our authors and readers, this journal provides supporting information supp...
Ngày tải lên: 15/03/2014, 10:20