Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

... solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds Enzio M. Ragg 1 , Valerio Galbusera 1 , Alessio Scarafoni 1 , Armando Negri 2 , Gabriella Tedeschi 2 , Alessandro ... inhibition assays Trypsin (TPCK-treated from bovine pancreas), a- chymo- trypsin (TLCK-treated from bovine pancreas), BApNA and GPpNA were p...
Ngày tải lên : 23/03/2014, 10:21
  • 16
  • 518
  • 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GT- cDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp). Construction and ... 3¢-RACE were: Primer C, 5¢-CCAGTGTCCCCAT CATCAG-3¢ and Primer D, 5¢-GGCAATTTTAAA GTCATTATGGCGCAAA-3¢. First strand cDNAs were synthesized using Superscript II RNase H...
Ngày tải lên : 17/03/2014, 03:20
  • 8
  • 465
  • 0
Báo cáo khoa học: Physical properties and surface activity of surfactant-like membranes containing the cationic and hydrophobic peptide KL4 potx

Báo cáo khoa học: Physical properties and surface activity of surfactant-like membranes containing the cationic and hydrophobic peptide KL4 potx

... collected from each sample between 15 and 70 °C. For each preparation, the analysis was repeated two or three times. The standard microcal origin soft- ware was used for data acquisition and analysis. ... surfactant-like membranes containing the cationic and hydrophobic peptide KL 4 Alejandra Sa ´ enz 1, *, Olga Can ˜ adas 1, *, Luı ´ s A. Bagatolli 2 , Mark E. Johnson 3 and Cristi...
Ngày tải lên : 30/03/2014, 11:20
  • 13
  • 329
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations as well as assignments of additional peaks based ... China Sea. Sephadex G-25 was purchased from Amersham Biosciences (Uppsala, Sweden), a ZORBAX 300SB-C18 semipreparative column was from Agilent Tech- nologies (Santa Clara...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf

... antagonist activities [8]. Analytical data have shown that the fatty acids in LPS of Chlamydiae have acyl chains with up to 22 carbon atoms and also that 3-hydroxy fatty acids occur only with amide-linkage ... Negative ion MALDI-TOF mass spectrum of LPS from C. trachomatis serotype E. Fig. 2. Negative ion MALDI-TOF mass spectra of lipid A isolated from C. trachomatis serotype E...
Ngày tải lên : 20/02/2014, 23:20
  • 11
  • 560
  • 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing ... Double-stranded cDNA was syn- thesized from the mRNA with a cDNA synthesis kit (TaKaRa, Tokyo, Japan) and used as an abalone cDNA libra...
Ngày tải lên : 20/02/2014, 23:20
  • 8
  • 511
  • 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... temperature until all free water was evaporated. After this, IR spectra were recorded at room temperature and at 37 °C. Usually, the original spectra were evaluated directly and a spectral analysis ... Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans Klaus Brandenburg 1 , Frauke Wagner 1 , Mareike Mu¨ ller 1 , Holger Hein...
Ngày tải lên : 21/02/2014, 00:20
  • 9
  • 665
  • 1
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... HepG 2 cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaIsiteandBack 6I ... kidney, thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland. Almost no expression was observed i...
Ngày tải lên : 08/03/2014, 08:20
  • 12
  • 584
  • 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA Bacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL Bicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV 130 ... Mountain View, CA, USA), and poly (A) + RNA was isolated using Oligo(dT)-Latex Super (Takara Shuzo Co.). cDNA was prepared from mRNA with a Zap-cDNA synthesis kit (Stratagene, La Jo...
Ngày tải lên : 16/03/2014, 05:20
  • 11
  • 488
  • 0
Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

... of automatic evalua- tion methods for generation in terms of adequacy and fluency on automatically generated English paraphrases. They find that the automatic metrics are reasonably good at measuring ... native speaker judgements on automatically gen- erated German text against automatic eval- uation metrics. We look at a number of metrics from the MT and Summarisation communities...
Ngày tải lên : 23/03/2014, 17:20
  • 4
  • 285
  • 0

Xem thêm