Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayfish (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf

Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayfish (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf

Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayfish (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf

... b-barrel structure found in vertebrates [12]. Vertebrate FABPs are involved in cellular fatty acid transport and utilization and compartmentalization of intracellular fatty acid storage, and also ... cellu- lar uptake and cytoplasmic trafficking of fatty acids, and modulation of the amount of RA available to nuclear receptors [1,20]. FABPs are found intracellu- larly...

Ngày tải lên: 23/03/2014, 10:21

11 545 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... Journal compilation ª 2011 FEBS 1853 Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae Malea M. Kneen 1 , Razvan Stan 1 , Alejandra Yep 2 , ... 182–191. 26 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search pro...

Ngày tải lên: 06/03/2014, 00:21

12 436 0
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... Bmo AAX39866 Tni APN4 AAK69605 Sli AAF37559 Hpu APN2 AAK58066 Hvi AAC36148 Pin AAX39865 Tni APN3 AAF01259 Pxy APN3 Q11000 Hvi AAN75694 Har APN2 AAF37560 Hpu APN3 AAF99701 Epo AAD31183 Ldi APN1 AAL83943 ... APN1 AAF08254 Hvi AAN75693 Har APN1 AAF37558 Hpu APN1 AAC33301 Bmo Q11001 Mse A pisum APN CAA66467 Pxy AAX39864 Tni APN2 AAD31184 Ldi APN2 BAA32140 Bmo P91885 Mse APN2 CAA10950 Pxy BAA3...

Ngày tải lên: 16/03/2014, 12:20

15 392 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

... 5’-TGC CCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletion CAT1 5’-CGC GGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacement CAT2 5’-GC TCTAGAAAGTACAGTCGGCATTAT-3’ XbaI stkP replacement PRTI 5’-CAATTGACCAGCCTTGAGCA-3’ ... expression UFKFP 5’-CGC GAATTCCGCAAGATATCGGATTAGGAA-3’ EcoRI stkP deletion UFKRP 5’-CGC GGATCCCTTGCCGATTTGGATCATTC-3’ BamHI stkP deletion DFKFP 5’-GC TCTAGAATCTACAAACCTAAAACA...

Ngày tải lên: 16/03/2014, 18:20

12 466 0
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

... (Val- Val-Tyr-Pro-Trp) was a gift from K. Fukasawa (Matsu- moto Dental University, Nagano, Japan). The anti-(rat liver DPP III) was prepared as described by Fukasawa et al.[2]. Goat anti-rabbit ... Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster Claire Mazzocco 1, *, Kayoko M. Fukasawa 2 , Patrick Auguste 3 and Jacques Puir...

Ngày tải lên: 17/03/2014, 10:20

9 357 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) a...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... that brominated fatty acid and ASA both associated with W81 in the same ligand binding site. The ligand binding activity of ASP3c was further investigated using displacement of ASA, a fatty acid ... 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRI restriction sit...

Ngày tải lên: 21/02/2014, 03:20

11 642 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... amino acid sequence of hemerythrin from Siphonosoma cumanense. Protein Seq Data Anal 3, 141–147. 43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain of ... importantly, two local maxima of  330 and 380 nm were also revealed. These maxima are typical of diiron-centre absorbance, and thus characteristic for all haemerythrins [12]. Th...

Ngày tải lên: 07/03/2014, 17:20

13 501 0
Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Báo cáo khoa học: Characterization of a high-affinity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... PA1b: five susceptible strains ÔS. oryzae WAA42, Benin, and Bouriz, S. zeamais LS, and S. granarius BrayardÕ and four fully resistant S. oryzae strains ÔISOR3, Mex1, China and GVÕ harboring a ... specific radioactivity of the 125 I-labelled PA1b, calculated by the ratio of the radioactivity measured by gamma counting and the amount of peptide evaluated by absorbance at 210 nm...

Ngày tải lên: 08/03/2014, 02:21

7 605 0
w