Báo cáo khoa học: Surface density of cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface ppt

Báo cáo khoa học: Surface density of cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface ppt

Báo cáo khoa học: Surface density of cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface ppt

... cellobiohydrolase on crystalline celluloses A critical parameter to evaluate enzymatic kinetics at a solid–liquid interface Kiyohiko Igarashi, Masahisa Wada, Ritsuko Hori and Masahiro Samejima Department of ... specific activity of Cel 7A for crystal- line cellulose. This approach has several advantages: (1) A max pro- vides a measure of the surface a...

Ngày tải lên: 23/03/2014, 10:21

10 289 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

... preinitiation state’ and as few as possible in other states of replication, and secondly the elaboration of a protocol for preparing a cell fraction that contains the cellular chromatin and specifically ... to contain a large amount of replicons arrested in the ‘hypoxic preini- tiation state’, ready to initiate replication as soon as normal pO 2 was restored. Replicons in other...

Ngày tải lên: 21/02/2014, 00:20

11 610 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... resemble that of AppA in the substrate- bound state. It therefore seems that PhyK is always kept in a conformation suitable for phytate binding, whereas AppA undergoes a distinct conformational change ... length of a helix A, the C a atoms N-terminal to or inside helix A are separated by large distances. The corresponding region in AppA shows severe conformational changes upo...

Ngày tải lên: 16/02/2014, 09:20

13 766 0
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

... response to acti- vation of AMPK cannot lead to production of ATP because of lack of mitochondrial ADP. As AMPK sti- mulates cellular fatty acid uptake [29] and the availab- ility of circulating ... ATP in ⁄ ADP in ratio, ATP to ADP ratio in the mitochondrial matrix; ATP out ⁄ ADP out ratio, extramitochondrial ATP to ADP ratio; C X m i , concentration control coefficient, qua...

Ngày tải lên: 19/02/2014, 05:20

15 547 0
Tài liệu Báo cáo khoa học: Major phosphorylation of SF1 on adjacent Ser-Pro motifs enhances interaction with U2AF65 doc

Tài liệu Báo cáo khoa học: Major phosphorylation of SF1 on adjacent Ser-Pro motifs enhances interaction with U2AF65 doc

... conformational changes. Indeed, experiments with phosphatase inhibi- tors, purified phosphatases and nonhydrolysable ATP analogues have shown that multiple phosphorylation and dephosphorylation ... input was loaded to allow quantification by phosphorimaging of the fraction of the 35 S-labelled proteins that was bound to the beads. The mean values of duplicates with stand- ard deviatio...

Ngày tải lên: 19/02/2014, 07:20

11 340 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

... AAAAAGCAGGCTCC GAAGGAGATATAAAA ATGAAAACTGATAGATTACTG yef1-attB2R AGAAAGCTGGGTG GATTGCAAAATGAGCCTGAC attB1 ACAAGTTTGTACAAAAAAGCAGGCT attB2 ACCACTTTGTACAAGAAAGCTGGGT yef1hisf CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC yef1hisr GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG pos5hisf CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC pos5hisr CTTAGA...

Ngày tải lên: 20/02/2014, 01:20

13 560 0
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

... pressurization and temperature equilibration. This inactivation was considerable, suggesting fast inactivation, as half of the enzyme was already inacti- vated after pressurization and equilibration at 400 ... stabilization of partially folded states that are often not significantly populated under more drastic conditions [15]. The inactivation plateau that indicates an intermediate stat...

Ngày tải lên: 07/03/2014, 03:20

9 341 0
Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx

Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx

... reperfusion of the rat heart that elevation of AMPK activity correlates with decreased ACC activity, decreased malonyl-CoA content andanincreasedrateofb-oxidation. Work from our laboratory had shown ... cyclic AMP [64] enhanced cardiac oxidation of readily available fatty acid when carbohydrate was also available; rather, enhancement of carbohydrate usage was favoured. Insulin decreas...

Ngày tải lên: 07/03/2014, 15:20

10 551 0
Báo cáo khoa học: Dual effect of echinomycin on hypoxia-inducible factor-1 activity under normoxic and hypoxic conditions docx

Báo cáo khoa học: Dual effect of echinomycin on hypoxia-inducible factor-1 activity under normoxic and hypoxic conditions docx

... 5¢-TTTGCTGGCCATCGGATT- 3¢; BNIP3 reverse, 5¢-ACCAAGTCAGACTCCAGTTCTT CA-3¢; aldolase forward, 5¢-GAATTGGATGAAAGATA AAGCCCTTA-3¢; aldolase reverse, 5¢-TTGCCAGACC ATCCGTACTG-3¢; RPL1 3A forward, 5¢-CTCAAGGTC GTGCGTCTGAA,-3¢: ... oxygen availability prevents these modifi- cations, leading to HIF- 1a accumulation, translocation into the nucleus and interaction with coactivators. On activation...

Ngày tải lên: 16/03/2014, 05:20

10 341 0
Báo cáo khoa học: The effect of heme on the conformational stability of micro-myoglobin doc

Báo cáo khoa học: The effect of heme on the conformational stability of micro-myoglobin doc

... conformation of this protein. To compare the unfolding of the individual helices of apo- lMb, the average rmsd of each helix after 1.5 ns of simulation was calculated over the backbone atoms relative ... experimentally, it can be taken as a model of an unstable intermediate in holo- lMb unfolding on loss of the cofactor. The MD simu- lation results provide an explanation...

Ngày tải lên: 16/03/2014, 06:20

8 516 1
w