Báo cáo khoa học: Functional characterization and Me2+ ion speciﬁcity of a Ca2+–citrate transporter from Enterococcus faecalis1 pdf

... Microbiologı´ a, Facultad de Ciencias Bioquı´micasy Farmace´uticas, Universidad Nacional de Rosario, ArgentinaAnalysis of a large set of bacterial genomes has shownthat, in spite of its high abundance ... FEBS Functional characterization and Me2+ ion speciﬁcity of a Ca2+–citrate transporter from Enterococcus faecalisVictor S. Blancato1,2, Christian Magni2 and Juke S. Lolkema11 Molecular Microbiology, ... Ca2+,Ba2+,Sr2+,Zn2+,Ni2+,Mg2+,Mn2+, and Co2+were added at a ﬁnal concentration of 2 mM.Cu2+,Cd2+ and Pb2+were added to a ﬁnal concentration of 1.1 mM. Uptakewas expressed as a percentage of the uptake obtained in a buffer...

Báo cáo khoa học: Solution parameters modulating DNA binding speciﬁcity of the restriction endonuclease EcoRV docx

... 2727Solution parameters modulating DNA binding speciﬁcity of the restriction endonuclease EcoRVNina Y. Sidorova, Shakir Muradymov and Donald C. RauLaboratory of Physical and Structural Biology, ... shift assay and by the self-cleavage assay. (A) A gelimage is shown illustrating a direct comparison of the EcoRV–DNAbinding by the gel mobility shift assay (left) and by the self-cleavageassay ... Weare deeply grateful to Dr Galina Obmolova (Centocor) and Dr Andrea Prota for their valuable advice regard-ing EcoRV puriﬁcation. This work was supported bythe Intramural Research Program of...

Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

... Oncometopia nigri-cans, accession number AAU95196; HC, Homalodisca coagulata,AAT01076; AF, Artemia franciscana, AAL55398; ON2, Oncorhyn-chus nerka, AAK08117; SS, Salmo salar, AAB34575; TN, Tetraodonnigroviridis, ... denaturation of citrate synthase in vitro ,a capability shared by apoferritin and ferritin, and con-fers stress tolerance on transfected mammalian cells.Artemin and ferritin may have arisen from ... primers5¢-GATCCTCGAGTTAACTATAGAAGACACGGG-3¢ and 5¢-AGCTCCTAGGGCAACAGAAGGTGCAAG-3¢,inserted into pCR2.1, and used to transform E. coli DH 5a. The insert was recovered from pCR2.1 with BamHI and XbaI, and cloned...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... Meyer-Klaucke for data collection and assis-tance in data evaluation. The assistance of T. Pavkov(Institute of Chemistry, University of Graz) in theacquisition of CD and DLS data is gratefully acknowl-edged. ... GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. Theprimers were designed to introduce restriction sites ... catalyzed breakdown of theb-diketone substrate via oxidative carbon–carbon bondcleavage to yield methylglyoxal and acetate.Kinetic characterization of Fe2+Bxe _A2 876The activity of Bxe _A2 876...

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... enzymatic characterization of HpSDH demonstrates its activity with kcat of 7.7 s)1 and Km of 0.148 mmtoward shikimate, kcat of 7.1 s)1 and Km of 0.182 mm toward NADP, kcat of 5.2 s)1 and ... 3-dehydroquinatedehydratase to form bifunctional enzyme [18,19]. Infungi and yeast, such as Aspergillus nidulans and Sac-charomyces cerevisiae, SDH exists as a component of the penta -functional AROM enzyme ... can oxidize shiki-mate using NAD as cofactor, which has a kcat of 5.2 ± 0.1 s)1 and Km of 2.9 ± 0.4 mm toward NAD.HpSDH shows a 10 times higher Kmfor NAD thanfor NADP at saturation of...

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... GAGGCTAGATACTGCTCGATGTIL-10 forward3 TGATGATTTGGAACCATTATTGAAIL-10 reverse3 CACCTTTTTCCTTCATCTTTTCATb-Actin forward1 ACTACCTCATGAAGATCCTGb-Actin reverse1 TTGCTGATCCACATCTGCTGT7- forward TAATACGACTCACTATAGGGSP6-reverse ... Cloning, characterization and expression analysis of interleukin-10 from the common carp,Cyprinus carpioL.Ram Savan1, Daisuke Igawa2 and Masahiro Sakai21United Graduate School of Agricultural ... study.Cloning and characterization of the carp IL-10 gene A carp cDNA library, produced following stimulation withconcanavalin A and LPS [18], was used to isolate the IL-10gene, employing IL-10-Fw2 and...

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... sequence of the coding region: 5¢TTACAAGGACAAATTAATTGTGCCAG. For ampliﬁcation of the long isoform the same 5¢ primers were used, the 3¢speciﬁc primer was FF3B: 5¢TTACAAGTCTTGCAAAGGGAAGGAT. For ampliﬁcation ... 1337Molecular characterization and allergenic activity of Lyc e 2(b-fructofuranosidase), a glycosylated allergen of tomatoSandra Westphal1, Daniel Kolarich2, Kay Foetisch1, Iris Lauer1, ... some serato a 9- and a 15-kDa band. We could show that the9-kDa band in the tomato extracts reacts with a speciﬁcantibody against the LTP from cherry, Pru av 3 and the15-kDa band shows reactivity...

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... mechanicaldisturbance leading to a conformational change of theprotein and, with that, signal transduction.Recently, Ben-Menachem3et al. [45] presented a physico-chemical characterization of ... Chicester.32. Mu¨hlradt, P.F. & Frisch, M. (1994) Puriﬁcation and partial bio-chemical characterization of a Mycoplasma fermentans-derivedsubstance that activates macrophages to release nitric oxide,tumor ... Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentansKlaus Brandenburg1, Frauke Wagner1, Mareike Mu¨ ller1, Holger Heine1,Jo¨ rg Andra¨1,...

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of ﬂavonol synthase from Citrus unshiu pptx

... origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are under investigation. The reactions arediverse, such as the desaturation of aliphatic ... cDNA.Data base retrievalData base searches and sequence alignments were carriedout with theENTREZ and BLASTsoftware (National Library of Medicine and National Institute of Health, Bethesda,MD, ... Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ﬁve gibberellinC20 oxidases (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum,...

Báo cáo khoa học: Molecular characterization and gene disruption of mouse lysosomal putative serine carboxypeptidase 1 ppt

... Scpep1 antiserum to detect the 35 kDa fragment and an anti-Ctsa rat IgG2B to detect the 32 kDa heavy chain of Ctsa.K. Kollmann et al. Functional characterization of lysosomal Scpep1FEBS Journal ... et al. Functional characterization of lysosomal Scpep1FEBS Journal 276 (2009) 1356–1369 ª 2009 The Authors Journal compilation ª 2009 FEBS 1369Molecular characterization and gene disruption of ... a- cathepsin D rabbit antiserum [35], a- Lamp1 ratIgG 2A (1D4B, Developmental Studies Hybridoma Bank,Iowa City, IA, USA) and a- Scpep1 antisera derived from rabbit and rat. Horseradish peroxidase- and ﬂuorescence-conjugated...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015