Báo cáo khoa học: Functional characterization and Me2+ ion specificity of a Ca2+–citrate transporter from Enterococcus faecalis1 pdf

... Microbiologı ´ a, Facultad de Ciencias Bioquı ´ micas y Farmace ´ uticas, Universidad Nacional de Rosario, Argentina Analysis of a large set of bacterial genomes has shown that, in spite of its high abundance ... FEBS Functional characterization and Me 2+ ion specificity of a Ca 2+ –citrate transporter from Enterococcus faecalis Victor S. Blancato 1,2 , Christian M...

Ngày tải lên: 23/03/2014, 10:20

... 2727 Solution parameters modulating DNA binding specificity of the restriction endonuclease EcoRV Nina Y. Sidorova, Shakir Muradymov and Donald C. Rau Laboratory of Physical and Structural Biology, ... shift assay and by the self-cleavage assay. (A) A gel image is shown illustrating a direct comparison of the EcoRV–DNA binding by the gel mobility shift assay (left) and by t...

Ngày tải lên: 22/03/2014, 16:20

... Oncometopia nigri- cans, accession number AAU95196; HC, Homalodisca coagulata, AAT01076; AF, Artemia franciscana, AAL55398; ON2, Oncorhyn- chus nerka, AAK08117; SS, Salmo salar, AAB34575; TN, Tetraodon nigroviridis, ... denaturation of citrate synthase in vitro ,a capability shared by apoferritin and ferritin, and con- fers stress tolerance on transfected mammalian cells. Artemin and...

Ngày tải lên: 16/03/2014, 11:20

... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data is gratefully acknowl- edged. ... GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers were...

Ngày tải lên: 18/02/2014, 06:20

... enzymatic characterization of HpSDH demonstrates its activity with k cat of 7.7 s )1 and K m of 0.148 mm toward shikimate, k cat of 7.1 s )1 and K m of 0.182 mm toward NADP, k cat of 5.2 s )1 and ... 3-dehydroquinate dehydratase to form bifunctional enzyme [18,19]. In fungi and yeast, such as Aspergillus nidulans and Sac- charomyces cerevisiae, SDH exists as a compon...

Ngày tải lên: 19/02/2014, 05:20

... GAGGCTAGATACTGCTCGATGT IL-10 forward3 TGATGATTTGGAACCATTATTGAA IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT b-Actin forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 TTGCTGATCCACATCTGCTG T7- forward TAATACGACTCACTATAGGG SP6-reverse ... Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. Ram Savan 1 , Daisuke Igawa 2 and Masahiro Sakai...

Ngày tải lên: 20/02/2014, 02:21

... sequence of the coding region: 5¢TTAC AAGGACAAATTAATTGTGCCAG. For amplification of the long isoform the same 5¢ primers were used, the 3¢ specific primer was FF3B: 5¢TTACAAGTCTTGCAA AGGGAAGGAT. For amplification ... 1337 Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato Sandra Westphal 1 , Daniel Kolarich 2 , Kay...

Ngày tải lên: 21/02/2014, 00:20

... mechanical disturbance leading to a conformational change of the protein and, with that, signal transduction. Recently, Ben-Menachem 3 et al. [45] presented a physico- chemical characterization of ... Chicester. 32. Mu ¨ hlradt, P.F. & Frisch, M. (1994) Purification and partial bio- chemical characterization of a Mycoplasma fermentans-derived substance that activates mac...

Ngày tải lên: 21/02/2014, 00:20

... origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are under investigation. The reactions are diverse, such as the desaturation of aliphatic ... cDNA. Data base retrieval Data base searches and sequence alignments were carried out with the ENTREZ and BLAST software (National Library of Medicine and National I...

Ngày tải lên: 21/02/2014, 03:20

... Scpep1 antiserum to detect the 35 kDa fragment and an anti- Ctsa rat IgG2B to detect the 32 kDa heavy chain of Ctsa. K. Kollmann et al. Functional characterization of lysosomal Scpep1 FEBS Journal ... et al. Functional characterization of lysosomal Scpep1 FEBS Journal 276 (2009) 1356–1369 ª 2009 The Authors Journal compilation ª 2009 FEBS 1369 Molecular characterization and...

Ngày tải lên: 07/03/2014, 03:20