... Saccharomyces cerevisiae coq10 null mutants are responsive to antimycin A Cleverson Busso 1 , Erich B. Tahara 2 , Renata Ogusucu 2 , Ohara Augusto 2 , Jose Ribamar Ferreira-Junior 3 , Alexander ... Alexander Tzagoloff 4 , Alicia J. Kowaltowski 2 and Mario H. Barros 1 1 Departamento de Microbiologia, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Brazil 2 Departmento de B...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Saccharomyces cerevisiae a1,6-mannosyltransferase has a catalytic potential to transfer a second mannose molecule ppt
... 2006 The Authors Journal compilation ª 2006 FEBS 5085 Saccharomyces cerevisiae a1 ,6-mannosyltransferase has a catalytic potential to transfer a second mannose molecule Toshihiko Kitajima, Yasunori ... (5¢-CAAGAGGTGGTATTTACTCAGCTATGGATA CTATGCTTTTGAA-3¢) and D18 8A- RV (5¢-TTCAAAAGC ATAGTATCCATAGCTGAGTAAATACCACCTCTTG-3¢), and the pPICZaA-ScOCH1 as a template. The...
Ngày tải lên: 23/03/2014, 10:20
... essential Saccharomyces cerevisiae Ybr004c protein as a candidate for the second GPI a- mannosyltransferase (GPI-MT-II). S. cerevisiae cells depleted of Ybr004cp have weakened cell walls and abnormal ... are unable to incorporate [ 3 H]inositol into proteins, and accumulate a GPI intermedi- ate having a single mannose that is likely modified with ethanolamine phosphate. Thes...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Saccharomyces cerevisiae Pip2p–Oaf1p regulates PEX25 transcription through an adenine-less ORE ppt
... 5¢- TCGACTCTCCGCCGGAAGAGGGTACCGACTTGTCGGAGGAATTCGGAGTG-3¢ This study PEX14 ORE1 (RE328) 5¢- AATTCATAGCGGTTTTAATAAGCGCCCGAAAGAG-3¢ This study PEX14 ORE2 (RE329) 5¢- TCGACTCTTTCGGGCGCTTATTAAAACCGCTATG-3¢ ... 5¢- TCGACCGGATCATCGCGATTAACTCCGG-3¢ This study PEX5 ORE1-R 5¢- TCGACCGGAGTTAATCGCGATGATCCGG-3¢ This study PEX5 ADR1-F 5¢- TCGACACTCCGAATTCCTCCGACAAGTCGGTACCCTCTTCCGGCGGAGAG-3¢ This study PE...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Saccharomyces cerevisiae Cox18 complements the essential Sec-independent function of Escherichia coli YidC doc
... by a small cytoplasmic loop and two translocated termini: a lipid-modified N-terminus and a large C-terminus. To permit immunodetection, an HA tag was attached to the C-terminus. (D) Steady state ... alkaline phosphatase were obtained from Invi- trogen (Carlsbad, CA, USA). Pansorbin was purchased from Merck (Darmstadt, Germany). Megashort script T7 tran- scription kit was obtained fr...
Ngày tải lên: 30/03/2014, 03:20
Tài liệu Báo cáo khoa học: Thermodynamic characterization of interleukin-8 monomer binding to CXCR1 receptor N-terminal domain ppt
... receptor N-domain using the vadar program [41]. The DC p was calculated using the following equa- tion: DC p ¼ 0:45DASA apolar À 0:26 ASA polar where DASA apolar and DASA polar are the changes ... approach is clearly an approximation; according to this parameterization, the changes in heat capacity arise from binding- induced changes in the solvent polar and apolar ASA. To evaluate the en...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... together, the initial additions of Cu(I) to each domain caused the disappearance of a large set of NOESY cross-peaks and the parallel appearance of another set of cross-peaks, until a clean 2D spectrum belonging ... towards a highly dynamic struc- ture [8]. Recently, a high-resolution solution structure of the C-terminal a- domain has become available. The data revealed a terti...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Entamoeba histolytica TATA-box binding protein binds to different TATA variants in vitro ppt
... _AAg(5) and TATTaAAA(6)), and for mutated versions of TATTTAAA(1) probe [oligonucleotides TAgTgAAA(2) and TATTggAA(3)] (Table 1). We ABCD E Fig. 1. Binding of nuclear extracts to TATTTAAA(1) oligonucleotide. ... TAT_ _AAg(5), and the largest to TAgTgAAA(2). Therefore, we could order the oligonucleotides according to their TBP affinity as follows: TATTTAAA(1) ¼ TAT_ _AAA(4) > TATTgg AA...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc
... tracheobronchi- al tree, nasal mucosa and sweat glands [25]. Human tear lipocalin has significant sequence homology with the human forms of OBP and, at least in humans, par- tially shares a similar tissue ... Montague DC, Ceci JD, Yang Y, Awasthi S, Awasthi YC & Zim- niak P (2004) Physiological role of mGSTA4-4, a glu- tathione S-transferase metabolizing 4-hydroxynonenal: generation...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: "What do we know about medication errors made via a CPOE system versus those made via handwritten orders"
... of errors made with CPOE systems compared to handwritten orders. I find in Shulman et al.’s article essential questions that are too often glossed over or assumed to have obvious answers. Their ... complexity of medication prescribing error Shulman and colleagues assign medication errors into a 12 category schema that illuminates the many types of medication prescribing errors and, key...
Ngày tải lên: 25/10/2012, 10:39