... cultivated around the world, including the oilseeds rapeseed and canola (Bras- sica napus and Brassica rapa) and vegetables such ase cabbage (Brassica oleraceae var. capitata), cauliflower (B. oleraceae ... by L. maculans and A. brassicicola catalyse the detoxification of brassinin by hydrolysis of its dithiocarbamate group to indolyl-3-methanamine. The purification and ch...
Ngày tải lên: 18/02/2014, 14:20
... Pwo polymerase (Roche Diagnostics GmbH, Mannheim, Ger- many) and primers rluD114::cat(pKD3) 5¢ (5¢-GCT ACA ATA GCA CAC TAT ATT AAA CGG CAA AGC CGT AAA ACC CC G TGT AGG CTG GAG CTG CTT CG- 3¢) and rluD114::cat(pKD3) ... rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AAT GTG AAA AGA AAA TCA CGC GTA CCG GAT CGT CTT G AT GGG AAT TAG CCA TGG TCC-3¢) (comple- mentary regions to the rluD-flanking regi...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Substrate specificity and transport mode of the proton-dependent amino acid transporter mPAT2 potx
... he amino acids glycine, alanine, serine and proline but also osmolytes such as sarcosine and betaine, and the D -enantiomers of serine and alanine. The apparent affinities of PAT1 substrates are ... measured at pH 6.5 for 10 min in the presence of unlabeled amino acids and derivatives at a fixed concentration of 10 m M andaregivenaspercentageinhibitionofthecont...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Substrate specificity of vaccinia virus thymidylate kinase docx
... triphosphate, the active form of acyclovir, targets the viral DNA polymerase and acts as a chain terminator after incorporation of acyclovir monophos- phate in DNA. Several bacterial TMP kinases are the focus ... dimeric area is totally conserved in the human and vaccinia enzymes. A BC Fig. 1. Sequence and model for the structure of vaccinia virus TMP kinase and...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Substrate specificity and excision kinetics of natural polymorphic variants and phosphomimetic mutants of human 8-oxoguanine-DNA glycosylase pot
... Post-translational modifications such as phosphorylation could affect the cellular distribution and enzymatic activity of OGG1. Mutations and polymorphisms of OGG1 may affect the enzymatic activity and ... sub- strate concentration in double reciprocal coordinates for the wild-type enzyme. The specificity constant, k sp = k cat ⁄ K m , was calculated for each enzyme and s...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAA CTCAGCCACTGGATGAATATAAAG Antisense CTTTATATTCATCCAGTGGCT GAGTTCTGTGGGCCACACCAG 2B4F33Y Sense CTGGTGTGGCCCACAGAA TACAGCCACTGGATGAATATAAAG Antisense CTTTATATTCATCCAGTGGCT GTATTCTGTGGGCCACACCAG 2B7Y33 ... CTTTATATTCATCCAGTGGCT GTATTCTGTGGGCCACACCAG 2B7Y33 L Sense CTGGTGTGGGCAGCAGAA CTCAGCCATTGGATGAATATAAAG Antisense CTTTATATTCATCCAATGGCT GAGTTCTGCTGCCCACACCAG 2B7Y33F Sense CTG...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo khoa học: Structural diversity in lipopolysaccharide expression in nontypeable Haemophilus influenzae Identification of L-glycero -D-manno-heptose in the outer-core region in three clinical isolates potx
... have identical struc- tures as found for 1209 and 1 233 (data not shown). Methylation analysis of the dephosphorylated OS revealed the same sugar derivatives as for the clinical isolate and the relative ... as described earlier [15]. The relative proportions of the various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation an...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
... 5¢-CGATCC AAGCTTTAAGGAGG AAtagGAAATGGAATTCATCGAAAAAATCCG-3¢ antisense primer, 5¢-TGCATCCA TCTAGAGCATTCA GC-3¢. The amplified PCR product was digested with HindIII and XbaI, separated by agarose gel ... under the above condi- tions. On the other hand, L -prolinamide was used as a substrate during the purification and characterization of recombinant amidase from E. coli transfor...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Site specificity of yeast histone acetyltransferase B complex in vivo pot
... was similar in all four strains, and was equally increased by HU treatment (as revealed with anti-ryH4). These data indicate that Hat2, but not Hif1, participates in the catalytic function of ... acetylated at position 5, 12, or 16; and anti-H3 acetylated at position 9, 14, 27, or 56. From Abcam (Cambridge, UK): anti-H4 acetylated at resi- due 8 or 91, and also a- ryH4, a...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Aglycone specificity of Escherichia coli a-xylosidase investigated by transxylosylation ppt
... an acceptor other than water, transglycosylation is catalyzed rather than hydrolysis. It is apparent that the conditions for aglycones at the glycosylation and Keywords acceptor specificity; aglycone-binding ... the intermediate at a near constant or steady-state level. In the reaction mixture, the effective concentration of water is constant, so the better the accommo...
Ngày tải lên: 23/03/2014, 07:20