Báo cáo khoa học: Substrate speciﬁcity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identiﬁcation of a critical aromatic amino acid residue at position 33 doc

Tài liệu Báo cáo khoa học: Substrate speciﬁcity and inhibition of brassinin hydrolases, detoxifying enzymes from the plant pathogens Leptosphaeria maculans and Alternaria brassicicola ppt

... cultivated around the world,including the oilseeds rapeseed and canola (Bras-sica napus and Brassica rapa) and vegetables such asecabbage (Brassica oleraceae var. capitata), cauliﬂower(B. oleraceae ... by L. maculans and A. brassicicola catalyse the detoxiﬁcation of brassinin by hydrolysis of its dithiocarbamate groupto indolyl-3-methanamine. The puriﬁcation and characterization of brassi-nin ... indicated that BHs have new substrate speciﬁcities with a new catalytic activity that can be designated asdithiocarbamate hydrolase. Investigation of the effect of various phytoal-exins on the activities...

Tài liệu Báo cáo khoa học: Substrate speciﬁcity of the pseudouridine synthase RluD in Escherichia coli doc

... Pwopolymerase (Roche Diagnostics GmbH, Mannheim, Ger-many) and primers rluD114::cat(pKD3) 5¢ (5¢-GCT ACAATA GCA CAC TAT ATT AAA CGG CAA AGC CGTAAA ACC CCG TGT AGG CTG GAG CTG CTT CG-3¢) and rluD114::cat(pKD3) ... rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AATGTG AAA AGA AAA TCA CGC GTA CCG GAT CGTCTT G AT GGG AAT TAG CCA TGG TCC-3¢) (comple-mentary regions to the rluD-ﬂanking regions are under-lined). The resulting ... to the RluA family [2]. Binding of RluA to one of its substrates, tRNAPheanticodonstem-loop, induces reorganization of the RNA [21]. Anability of the RNA substrate to adopt the alternativefold...

Báo cáo khoa học: Substrate speciﬁcity and transport mode of the proton-dependent amino acid transporter mPAT2 potx

... he amino acids glycine, alanine, serine and proline but also osmolytes such as sarcosine and betaine, and the D-enantiomers of serine and alanine. The apparent afﬁnities of PAT1 substrates are ... measured at pH 6.5 for 10 min in the presence of unlabeled amino acids and derivatives at a ﬁxed concentration of 10 mMandaregivenaspercentageinhibitionofthecontroluptakemeasuredintheabsenceofinhibiton.Data ... whereas those of PAT1 are in the range of 1–15 mM[2,7,9,10]. PAT1 recognizes, besidesL -a amino acids, a number of additional substrates, e .g. b-alanine,c-aminobutyrate (GABA), betaine,D-Ser,...

Báo cáo khoa học: Substrate speciﬁcity of vaccinia virus thymidylate kinase docx

... triphosphate, the active form of acyclovir,targets the viral DNA polymerase and acts as a chainterminator after incorporation of acyclovir monophos-phate in DNA. Several bacterial TMP kinases are the focus ... dimeric area is totally conserved in the human and vaccinia enzymes. A BCFig. 1. Sequence and model for the structure of vaccinia virus TMP kinase and the human enzyme. (A) Alignment of the amino acid sequence ... unable to compete with MABA-dTDPin the assay. ATP and GTP also failed to displaceMABA-dTDP, but the presence of ADP favorablyincreased the afﬁnity of dTDP and dTMP, by a factor of two as also...

Báo cáo khoa học: Substrate speciﬁcity and excision kinetics of natural polymorphic variants and phosphomimetic mutants of human 8-oxoguanine-DNA glycosylase pot

... Post-translational modiﬁcations such as phosphorylationcould affect the cellular distribution and enzymatic activity of OGG1.Mutations and polymorphisms of OGG1 may affect the enzymatic activity and ... sub-strate concentration in double reciprocal coordinatesfor the wild-type enzyme. The speciﬁcity constant,ksp= kcat⁄ Km, was calculated for each enzyme and substrate, and the ratio of the ... similar. The values of kcat and Kmfor FapyGua excision wereTable 4. Km, kcat and kspvalues for excision of FapyGua and 8-oxoGua from c-irradiated calf thymus DNA by wild-type and mutant...

Báo cáo khoa học: Substrate speciﬁcity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identiﬁcation of a critical aromatic amino acid residue at position 33 doc

... CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAGAntisense CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG2B4F33Y Sense CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAGAntisense CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG2B7Y33 ... CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG2B7Y33 L Sense CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAGAntisense CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG2B7Y33F Sense CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAGAntisense ... Substrate speciﬁcity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identiﬁcation of a critical aromatic amino acid residue at position 33 Lydia Barre1, Sylvie Fournel-Gigleux1,...

Báo cáo khoa học: Structural diversity in lipopolysaccharide expression in nontypeable Haemophilus inﬂuenzae Identiﬁcation of L-glycero -D-manno-heptose in the outer-core region in three clinical isolates potx

... have identical struc-tures as found for 1209 and 1 233 (data not shown).Methylation analysis of the dephosphorylated OS revealed the same sugar derivatives as for the clinical isolate and the relative ... asdescribed earlier [15]. The relative proportions of the variousalditol acetates and partially methylated alditol acetatesobtained in sugar- and methylation analyses correspond to the detector ... isolates thatexpress LPS with unusual features but that are very similarto each other. These are 1209 and 1207 obtained from the same otitis media patient on the same day (left and right earisolates)...

Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc

... 5¢-CGATCCAAGCTTTAAGGAGGAAtagGAAATGGAATTCATCGAAAAAATCCG-3¢antisense primer, 5¢-TGCATCCATCTAGAGCATTCAGC-3¢. The ampliﬁed PCR product was digested withHindIII and XbaI, separated by agarose gel ... under the above condi-tions. On the other hand,L-prolinamide was used as a substrate during the puriﬁcation and characterization of recombinant amidase from E. coli transformant. The standard ... characterized, and found to be a novelL-stereoselective amino acid amidase, LaaA. This is the ﬁrst report revealing the primary structure of L -amino acid amidase.Materials and methodsBacterial strains,...

Báo cáo khoa học: Site speciﬁcity of yeast histone acetyltransferase B complex in vivo pot

... wassimilar in all four strains, and was equally increased byHU treatment (as revealed with anti-ryH4). These dataindicate that Hat2, but not Hif1, participates in the catalytic function of ... acetylated at position 5, 12, or16; and anti-H3 acetylated at position 9, 14, 27, or 56.From Abcam (Cambridge, UK): anti-H4 acetylated at resi-due 8 or 91, and also a- ryH4, anti-H3 acetylated at posi-tion ... plusQMA cartridges (Waters, Milford, MA, USA), and employed for the in vitro HAT speciﬁcity assays.HAT assaysFor determination of enzymatic activity in chromatographicfractions, a new assay method...

Báo cáo khoa học: Aglycone speciﬁcity of Escherichia coli a-xylosidase investigated by transxylosylation ppt

... an acceptor other than water, transglycosylationis catalyzed rather than hydrolysis. It is apparent that the conditions for aglycones at the glycosylation and Keywordsacceptor speciﬁcity; aglycone-binding ... the intermediate at a near constant or steady-state level. In the reaction mixture, the effective concentration of water is constant, so the better the accommodation of the acceptor substrate in the aglycone ... quanti-ﬁcation was calculated based on a decrease in acceptor sub-strate peak area when compared with control samples.Calibration of the peak area was performed based on inter-nal standard...

Xem thêm