Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf
... USA). Plasmids and cloning procedures For heterologous expression in yeast, N. crassa HEX1 was amplified from a N. crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA CGAC) ... typical hexagonal shape of a N. crassa Woronin body. (C) A giant rectangular Woronin body is captured from the side. (D) A small Woronin body is still attached to a perox...
Ngày tải lên: 23/03/2014, 07:20
... 5349 by following the changes in the 695 nm absorbance band. It appears clear that both anions favor protein collapse into a compact form, and induce formation of a consistent population of macromolecules ... the K88E mutation introduces an acidic resi- due (E88, present in yeast [28]) in place of a lysine, whereas in site 2, the K13N mutation introduces an asparagine...
Ngày tải lên: 19/02/2014, 05:20
... 1827–1834. 17 Cai G, Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S & Ozono K (1998) Analysis of localization of mutated tissue-nonspecific alkaline ... fraction). BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as mole- cular mass markers. K. Komaru et al. Novel aggr...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Amyloid oligomers: formation and toxicity of Ab oligomers ppt
... cells into a neuronal Fig. 2. Formation and toxicity mechanisms of intracellular Ab oligomers. Ab can be localized intracellularly by the uptake of extracellular Ab or by the cleavage of APP in ... [56,57]. Alpha-synuclein is an aggregation-prone protein that causes Parkinson’s disease (PD), and interactions between a- synuclein and Ab therefore indicate that AD and PD could be...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTC ATCGTCTTT GTAGTCC ATGG TGGT-3¢, respectively. pBOS-HA-pVHL was constructed by inserting ... similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Nitric oxide formation from the reaction of nitrite with carp and rabbit hemoglobin at intermediate oxygen saturations pdf
... oxygenated carp Hb at 100% So 2 was clearly autocatalytic. The reac- tion rate initially showed a sharp increase, reached a marked peak and then displayed a decrease, as the reaction approached ... deconvolution instead proposed the transient appearance of small amounts of deoxyHb and HbNO (fitting artifacts) during the autocatalytic phase (Fig. 2F). In order to study how an increa...
Ngày tải lên: 16/03/2014, 06:20
Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx
... in insects. Annu Rev Entomol 51, 1–24. 7 Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY & Ishizaki H (1986) Amino acid sequence of a protho- racicotropic ... for wing imaginal disks in Lepidoptera. Proc Natl Acad Sci USA 99, 15446–15450. 30 Satake S, Masumura M, Ishizaki H, Nagata K, Kataoka H, Suzuki A & Mizoguchi A...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Amino acid discrimination by arginyl-tRNA synthetases as revealed by an examination of natural specificity variants doc
... obtained when assayed with non-radioactive cana- vanine using the [ 32 P]-labelled tRNA assay [28]. For the jack bean enzyme, a distinct discrimination between arginine and canavanine for aminoacylation ... tRNA with the enzyme plays a significant role in determining the accuracy of tRNA arginylation. Of the potential amino acid substrates tested, apart from l-canavanine, only l-thio...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx
... subtrees are specified in advance, in an adaptor grammar the subtrees, as well as their probabilities, are learnt from the train- ing data. In order to make parsing and inference tractable we require ... an adaptor gram- mar is a PCFG in which a subset M of the nonter- minals are adapted. An adaptor grammar generates the same set of trees as the CFG with the same rules, but ins...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: "Mining User Reviews: from Specification to Summarization Xinfan Meng Key Laboratory of Computational Linguistics " doc
... vocabu- lary of product features. Hierarchy struc- ture information and unit of measurement information are mined from the specifi- cation to improve the accuracy of feature extraction. At summary ... generation stage, hierarchy information in specifications is used to provide a natural conceptual view of product features. 1 Introduction Review mining and summarization aims to extra...
Ngày tải lên: 20/02/2014, 09:20