Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf

Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf

Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf

... 138 –147 ª 2007 The Authors Journal compilation ª 2007 FEBS 147 Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase ⁄ reductase with a retinaldehyde reductase activity Olga ... 4). Activity assays showed that purified RDH13–His6 was indeed active towards all-trans -retinaldehyde and appeared to prefer NADPH to NADH as a co...
Ngày tải lên : 23/03/2014, 07:20
  • 10
  • 674
  • 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

... Molecular Graphics System. DeLano Scientific, San Carlos, CA, USA. 41 Wallace AC, Laskowski RA & Thornton JM (1995) LIGPLOT: a program to generate schematic diagrams of protein–ligand interactions. ... GluR -A and of two variant PDZ2 domains in unliganded state at 1.8–2.44 A ˚ resolutions. SAP97 PDZ2 folds to a compact globular domain comprising six b-strands and two a- helices, a...
Ngày tải lên : 30/03/2014, 10:20
  • 11
  • 458
  • 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... maintenance, and is essential for chromo- somal DNA replication. Proc Natl Acad Sci USA 93, 12309–12314. 13 Mimura S, Masuda T, Matsui T & Takisawa H (2000) Central role for cdc45 in establishing ... antibody on formalin-fixed and paraffin-embedded tissues (Fig. 9). Antibodies against PCNA and Cdc45 stained malignant cells in a compar- able manner, e.g. on invasive-lobular mamma carci...
Ngày tải lên : 19/02/2014, 00:20
  • 16
  • 504
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATC...
Ngày tải lên : 19/02/2014, 05:20
  • 14
  • 517
  • 0
Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx

Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx

... QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA): C153S-up, 5¢-TGCATC TTGCACTACCAACTCTCTTGCTCCCTTTGTC-3¢; and C153S-down, 5¢-TGACAAAGGGAG CAAGA GAGTTGG TAGTGCAAGATGC-3¢. ... triangles). NADPH-dependent activity is given as a percentage of the initial activity. (B) Reversal of A 4 -GAPDH inactiva- tion by dithiothreitol. A 4 -GAPDH was inactivated by incubat...
Ngày tải lên : 19/02/2014, 05:20
  • 15
  • 515
  • 0
Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx

Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx

... (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGGCTCACCACCACA CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCG PfG6PD-6PGL (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG PfGPx ... AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCG PfTrxR (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG PfSOD (PF...
Ngày tải lên : 19/02/2014, 07:20
  • 10
  • 437
  • 0
Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc

Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc

... Journal 272 (2005) 2869–2877 ª 2005 FEBS 2875 5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTT ACAGTAATATAAAGAATTTCGCTCTAGATCAAGGA CCTCCCGCAAGCGCGAG-3¢; and AP2-R, 5¢-TTACA GTAATATAAAGAATTTCGCTCTAGA-3¢, ... MgCl 2 using an ALS Electrochemical Analyzer 62 4A, and the potential was deter- mined by averaging the anodic and cathodic peak potentials. Presteady-state kinetic studies Presteady-state red...
Ngày tải lên : 19/02/2014, 18:20
  • 9
  • 513
  • 0
Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: Human intrinsic factor expressed in the plant Arabidopsis thaliana doc

... potential as a large-scale source of human IF for analytical and therapeutic purposes. Keywords: arabidopsis; cobalamin; intrinsic factor; recom- binant. Vitamin B 12 (cobalamin, Cbl) is the ... signal peptide (Ext) with the amino acid sequence MASSSIALFLALNL LFFTTISA and 47 nucleotides from the 5¢-untranslated region. This sequence is part of the plant A. thaliana cDNA sequence in...
Ngày tải lên : 21/02/2014, 00:20
  • 6
  • 492
  • 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

... Hill Road Palo Alto, CA 94304, USA mforst@parc.com Abstract In this paper we present a human- based evaluation of surface realisation alterna- tives. We examine the relative rankings of naturally ... European Chapter of the ACL, pages 112–120, Athens, Greece, 30 March – 3 April 2009. c 2009 Association for Computational Linguistics Human Evaluation of a German Surface Realisation Rank...
Ngày tải lên : 22/02/2014, 02:20
  • 9
  • 479
  • 0
Báo cáo khoa học: Human kynurenine aminotransferase II – reactivity with substrates and inhibitors potx

Báo cáo khoa học: Human kynurenine aminotransferase II – reactivity with substrates and inhibitors potx

... transamination. Abbreviations AAD, a- aminoadipate; AlaAT, alanine aminotransferase; AspAT, aspartate aminotransferase; BCA, b-chloroalanine; CNS, central nervous system; CSA, cysteine sulfinate; ESBA, (R)-2-amino-4-(4-(ethylsulfonyl))-4-oxobutanoic ... S, Cartiaux M & Urrestarazu A (1998) Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferas...
Ngày tải lên : 06/03/2014, 00:21
  • 19
  • 401
  • 0

Xem thêm

Từ khóa: