Báo cáo khoa học: A proﬁle of the residues in the second ext

Báo cáo khoa học: A proﬁle of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

... 128–137 ª 2007 The Authors Journal compilation ª 2007 FEBS 137 A proﬁle of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor Feng ... provide further speciﬁc ligand- binding information. The ligand- binding data for some mutants, such as W17 6A and L172I, showed an increase t...

Ngày tải lên : 23/03/2014, 07:20

10
354
0

Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx

... (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnI sites to produce pTSd. The cDNA fragment ... reported that the alternative splicing of hippostasin is regulated in a cancer-speciﬁc manner [16]. In addition, serum levels of hippostasin are increased in patients wit...

Ngày tải lên : 16/03/2014, 23:20

13
483
0

Báo cáo khoa học: "A Tradeoff between Compositionality and Complexity in the Semantics of Dimensional Adjectives" potx

... of relations that appear in the knowledge base. Thus in the present paper, I investigate the kinds of relations that appear in formal theories of the meanings of the following morphosyntactic ... unacceptable for an applica- tion if it is crucial that the inferred intervals contain precisely those values that are warranted by the constraints an...

Ngày tải lên : 01/04/2014, 00:20

10
537
0

Báo cáo khoa học: Expression proﬁle of PIN, AUX ⁄ LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress pot

... PIN trafﬁcking, and provides an additional mechanism for the ﬁne regulation of auxin transport [26]. The para- logs of AUX1, LAX1, LAX2 and LAX3 maintain phyllotactic patterning, and buffer the PIN-mediated patterning ... Bootstrap values are presented for all branches. (A) PIN: data on AtPIN and OsPIN families (Tables S3 and S4) is based on TAIR annotation and Wang et al. [18...

Ngày tải lên : 29/03/2014, 09:20

16
417
0

Báo cáo khoa học: A sucrose binding protein homologue from soybean exhibits GTP-binding activity that functions independently of sucrose transport activity pptx

... increase the total protein extract as starting material in the binding reaction led to a remarkable increase in the background levels compromising the quality and interpretation of the data. The ... for the wild-type protein (compare lanes 1 and 3). The presence of high molecular mass migrating forms of the mutated protein in the absence of 2- mercaptoeth...

Ngày tải lên : 23/03/2014, 21:21

11
343
0

Báo cáo khoa học: A novel, promoter-based, target-speciﬁc assay identiﬁes 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx

... B4GalT6, GM3S and GAPDH cDNA, the following primers were used: for B4GalT6, the forward primer 5¢-TGAACAGACTGGCA CACAACC-3¢ and the reverse primer 5¢-TGTCAGCCC ACTTACACCAC-3¢; for GM3S, the forward ... forward primer 5¢- CGTCCCCACAATCGGTGTCA-3¢ and the reverse primer 5¢-ACCACTCCCTCTTTGACCAG-3¢; for GAPDH, the forward primer 5¢-CCACCCATGGCAAATTCCATGGCA -3¢ and the reverse p...

Ngày tải lên : 30/03/2014, 01:20

12
303
0

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... mitochon- drial respiratory chain. Biochem J 386, 255–261. 9 Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C (2005) Transactivation of the EGF receptor and a PI3 kinase-ATF-1 pathway is involved in ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy- agishi M, Taira K & Yabe-Nishimura C (2005) Essen- tial role of ATF-1 in induction of NOX1, a catalytic subunit of...

Ngày tải lên : 30/03/2014, 03:20

9
452
0

Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... direct interaction with their membranes. Materials and methods Materials All chemicals were of the purest analytical grade available. Proteases, aprotinin, lysozyme, and a- casein were from Sigma-Aldrich. ... and to other extracellular matrix proteins that are not protease inhibitors but contain Kazal-like motifs. The closest relatives of PSKP-1 are serine protease inhibitors...

Ngày tải lên : 30/03/2014, 13:20

10
456
0

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... Committee. Acetylcholine, atropine, concanavalin A, CCK-8 and CCK-8-NS were obtained from Sigma-Aldrich. Alamar blue was obtained from Astral Scientiﬁc (Caringbar, New South Wales, Australia). Guinea pigs weighing approximately ... Bioscience, The University of Queensland, Brisbane, Queensland, Australia Marsupials are born in an immature state and many of the developmental proce...

Ngày tải lên : 19/02/2014, 16:20

11
638
0

Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx

... which the subtrees are speciﬁed in advance, in an adaptor grammar the subtrees, as well as their probabilities, are learnt from the train- ing data. In order to make parsing and inference tractable ... repeatedly drawing a ball at random from the urn and then returning it plus an additional ball of the same color to the urn. In an adaptor grammar there is one DP f...

Ngày tải lên : 20/02/2014, 09:20

9
643
0