Báo cáo khoa học: Human haptoglobin structure and function – a molecular modelling study pptx
... Human haptoglobin structure and function – a molecular modelling study F. Polticelli 1 , A. Bocedi 1 , G. Minervini 1 and P. Ascenzi 1,2 1 Department of Biology and Interdepartmental Laboratory ... covalent multimers [11]. Data regarding the molecular details of monomeric HPT1 and HPT2 variants and oligomers are very scarce. No 3D structure is available for...
Ngày tải lên: 23/03/2014, 06:20
... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATC...
Ngày tải lên: 19/02/2014, 05:20
... has been found that eRF1 and eRF3 form ternary and quaternary complexes in solution with GTP and Mg 2+ (eRF1–eRF3–GTP and eRF1–eRF3–GTP– Mg 2+ ) [17]. Yeast two-hybrid and deletion analyses have ... corresponding part of the crystal structure [19]. Four b-strands (b1, 30 1–3 03; b2, 32 0–3 23; b6, 38 9–3 92; and b7, 40 9–4 12) form a b-sheet with three antiparallel str...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: High resolution structure and catalysis of O-acetylserine sulfhydrylase isozyme B from Escherichia coli pot
... usual range and does not change for T68S and R21 0A. In contrast, mutants Q14 0A and T6 8A showed much higher temperature dependence factors, corresponding to an appreciable increase in the activation ... substrate analog citrate, has been determined at 1.33 A ˚ resolution by X-ray diffraction analysis. The C1-carboxylate of citrate was bound at the carboxylate position of O-acetyls...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf
... Germany). Alkaline phosphatase-conjugated goat anti-(rabbit Ig) and rabbit anti-(mouse Ig) serum was pur- chased from JacksonImmunoResearch Laboratories (West Grove, PA, USA), a mouse monoclonal ... protein, creatinase, and the marker proteins gave negative reaction in the glycan staining and appear brown (Fig. 2A) . Finally, enzymatic deglycosylation with PNGase F resulted in a red...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Human metallothioneins 2 and 3 differentially affect amyloid-beta binding by transthyretin doc
... 2 and 3 differentially affect amyloid-beta binding by transthyretin Ana Martinho 1 , Isabel Gonc¸alves 1 , Isabel Cardoso 2 , Maria R. Almeida 2,3 , Telma Quintela 1 , Maria J. Saraiva 2,3 and ... under a 12 : 12 h light ⁄ dark cycle and given standard laboratory chow and water ad libitum. Euthanasia was carried after anaesthesia with Clorketam 1000 (50 lL per rat; Vetoquinol SA, Lu...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Human-blind probes and primers for dengue virus identification Exhaustive analysis of subsequences present in the human and 83 dengue genome sequences doc
... all dengue; absence in human not considered 201484200 Human- blindonechangeaway 81282200 Human- blind two changes away 0 0 20000 Human- blind three changes away 0 0 00000 Human- blindfourchangesaway ... that are unique to a particular genome is less than 8%, and many genomes have no human- blind n-mers at least two changes away from the nearest human sequence. Despite this low av...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo khoa học: Identification, structure and differential expression of novel pleurocidins clustered on the genome of the winter flounder, Pseudopleuronectes americanus (Walbaum) ppt
... These data can be used as a basis for prediction of antimicrobial peptide candidates for both human and nonhuman therapeutants from genomic sequences and will aid in understanding the evolution and transcriptional ... RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACC RTWF5. 1a/ 3¢ PFIKPR a CCTGGGTTTAATAAATGG Actin ActF(WF) AALVVD TCGCTGCCCTCGTTGTTGAC ActR(WF) VLLTEAP a GGAGCCTCGGTCAGCAGGA a...
Ngày tải lên: 31/03/2014, 07:20
Tài liệu Báo cáo khoa học: "Automated Vocabulary Acquisition and Interpretation in Multimodal Conversational Systems" pptx
... Griffin and Bock, 2000; Tenenhaus et al., 1995) and recent investigations on computa- tional models for language acquisition and ground- ing (Siskind, 1995; Roy and Pentland, 2002; Yu and Ballard, ... naturally co-occurred eye gaze and spoken utter- ances during human machine conversation to auto- matically acquire and interpret vocabularies. Motivated by psycholinguistic studi...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx
... Core Facility (Yale University, New Haven, CT, USA). Primers to amplify mature NlpI (residues 2 0–2 94) were 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢. 3-TPR ... 5¢-attattggatccctattgctggtccgattctgccag-3¢. 3-TPR NlpI primers (residues 6 2–1 97) were 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc ctt...
Ngày tải lên: 07/03/2014, 16:20