Báo cáo khoa học: Human haptoglobin structure and function – a molecular modelling study pptx

... Human haptoglobin structure and function – a molecular modelling study F. Polticelli1, A. Bocedi1, G. Minervini1 and P. Ascenzi1,21 Department of Biology and Interdepartmental Laboratory ... covalentmultimers [11].Data regarding the molecular details of monomericHPT1 and HPT2 variants and oligomers are veryscarce. No 3D structure is available for any of the human HPT variants, ... b-chains areseparated by two a- chains in a linear arrangement(Fig. 3). The minimum and maximum distance betweenthe two heavy b-chains in the modelled HPT1 dimerare approximately 60 and 130 A ˚,...

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(G) ... SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1...

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

... has been found that eRF1 and eRF3 form ternary and quaternary complexes in solution with GTP and Mg2+(eRF1–eRF3–GTP and eRF1–eRF3–GTP–Mg2+) [17]. Yeast two-hybrid and deletion analyseshave ... corresponding part ofthe crystal structure [19]. Four b-strands (b1, 30 1–3 03;b2, 32 0–3 23; b6, 38 9–3 92; and b7, 40 9–4 12) form a b-sheet with three antiparallel strands (1, 2 and 7) and strand 6, which ... signalof the preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signalof the preceding amino acid, correlating the amide NH withthe Ca and...

Báo cáo khoa học: High resolution structure and catalysis of O-acetylserine sulfhydrylase isozyme B from Escherichia coli pot

... usualrange and does not change for T68S and R21 0A. Incontrast, mutants Q14 0A and T6 8A showed muchhigher temperature dependence factors, correspondingto an appreciable increase in the activation ... substrate analog citrate,has been determined at 1.33 A ˚resolution by X-ray diffraction analysis.The C1-carboxylate of citrate was bound at the carboxylate position ofO-acetylserine, whereas ... in a reductionpathway that begins with sulfate and requires dioxy-gen. In contrast, CysM has a characteristic mainchain variation around position 210 that opens theactive center for larger...

Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

... Germany). Alkaline phosphatase-conjugatedgoat anti-(rabbit Ig) and rabbit anti-(mouse Ig) serum was pur-chased from JacksonImmunoResearch Laboratories (WestGrove, PA, USA), a mouse monoclonal ... protein,creatinase, and the marker proteins gave negativereaction in the glycan staining and appear brown(Fig. 2A) . Finally, enzymatic deglycosylation withPNGase F resulted in a reduction of molecular ... Hayek B, Vangelista L, Pastore A, Sperr WR, Valent P,Vrtala S, Niederberger V, Twardosz A, Kraft D &Valenta R (1998) Molecular and immunologic charac-terization of a highly cross-reactive...

Báo cáo khoa học: Human metallothioneins 2 and 3 differentially affect amyloid-beta binding by transthyretin doc

... 2 and 3 differentially affectamyloid-beta binding by transthyretinAna Martinho1, Isabel Gonc¸alves1, Isabel Cardoso2, Maria R. Almeida2,3, Telma Quintela1,Maria J. Saraiva2,3 and ... under a 12 : 12 h light ⁄ dark cycle and given standard laboratory chow and water ad libitum.Euthanasia was carried after anaesthesia with Clorketam1000 (50 lL per rat; Vetoquinol SA, Lure, France) ... vivo and in vitro [30]. Becauseboth TTR and MTs have an impact on Ab metabo-lism, we investigated the interaction between TTR and MT3, and characterized the impact of the TTR–MT2 and TTR–MT3...

Báo cáo khoa học: Human-blind probes and primers for dengue virus identiﬁcation Exhaustive analysis of subsequences present in the human and 83 dengue genome sequences doc

... all dengue; absencein human not considered201484200 Human- blindonechangeaway 81282200 Human- blind two changes away 0 0 20000 Human- blind three changes away 0 0 00000 Human- blindfourchangesaway ... thatare unique to a particular genome is less than 8%, and many genomes have no human- blind n-mers at leasttwo changes away from the nearest human sequence.Despite this low average, there are ... dengue identiﬁcation using nucleicacid-based technologies [3] such as the PCR [ 4–1 4] and nucleic acid sequence-based ampliﬁcation (NASBA)assays [15,16], and microarrays of cDNA [17] and oligonucleotides...

Báo cáo khoa học: Identiﬁcation, structure and differential expression of novel pleurocidins clustered on the genome of the winter ﬂounder, Pseudopleuronectes americanus (Walbaum) ppt

... These data can be used as a basis forprediction of antimicrobial peptide candidates for both human and nonhuman therapeutants from genomicsequences and will aid in understanding the evolution and transcriptional ... RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACCRTWF5. 1a/ 3¢ PFIKPR a CCTGGGTTTAATAAATGGActin ActF(WF) AALVVD TCGCTGCCCTCGTTGTTGACActR(WF) VLLTEAP a GGAGCCTCGGTCAGCAGGA a Primer based on complement.Table 2. Properties ... SFDDNP a GGGTTGTCATCGAATGAGWFX RTWFX RSTEDI CGTTCTACAGAGGACATCRTWFX/3¢ DDDDSP a GGGGCTGTCATCATCATCWFY (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACCRTWF5.1/3¢ GYLNAA a GGCCGCATTGAGATAACCWFZ (Y1)...

Tài liệu Báo cáo khoa học: "Automated Vocabulary Acquisition and Interpretation in Multimodal Conversational Systems" pptx

... Grifﬁn and Bock, 2000; Tenenhauset al., 1995) and recent investigations on computa-tional models for language acquisition and ground-ing (Siskind, 1995; Roy and Pentland, 2002; Yu and Ballard, ... naturally co-occurred eye gaze and spoken utter-ances during human machine conversation to auto-matically acquire and interpret vocabularies.Motivated by psycholinguistic studies (Just and Carpenter, ... effective human machine conversation,it is important for a conversational system to haveknowledge about user vocabularies and understandhow these vocabularies are mapped to the internalentities...

Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

... Core Facility (Yale University,New Haven, CT, USA). Primers to amplify mature NlpI(residues 2 0–2 94) were 5¢-aataatccatggggagtaatacttcctggcgtaaaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢.3-TPR ... 5¢-attattggatccctattgctggtccgattctgccag-3¢.3-TPR NlpI primers (residues 6 2–1 97) were 5¢-aataatccatgggggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttccttatccgatttttcgaagtgc-3¢. PCR products were ... HelsinginSanomat Centennial Foundation (Finland). Data forthis study were measured at beamline X12C of theNational Synchrotron Light Source. We are gratefulfor the assistance of Dr Anand Saxena in...

Xem thêm