An Analysis of Small Business and Jobs by Brian Headd Office of Advocacy pot
... Administration, Office of Advocacy, and contains information and analysis that was reviewed and edited by officials of the Office of Advocacy. However, the final conclusions of the report do not ... http://papers.nber.org/papers/4492, 1993. Headd, Brian and Bruce Kirchhoff, “The growth, decline and survival of small businesses: An exploratory study of...
Ngày tải lên: 23/03/2014, 05:22
... business assets. About 40% of small business loans and close to 60% of loan dollars are guaranteed and/ or secured by personal assets (Ang, Lin, and Tyler 1995, Avery, Bostic, and Samolyk 1998). Combining ... banks and life insurance companies (1870), and endowments and foundations (12%) (Fenn, Liang, and Prowse 1997). The limited partners typically put up 98% or mo...
Ngày tải lên: 15/03/2014, 21:20
... and the range of temperature change is comparatively smaller. Elevation data and land use information were also considered in the model to incorporate the effects of ground geography and land ... comprehensive plan; indicator and explanation, Japan Society of Sewerage System. (in Japanese) MLIT (Ministry of Land, Infrastructure, Transport and Tourism) (2003). Block-wise...
Ngày tải lên: 05/09/2013, 10:17
Tài liệu The characteristics of small-business employees ppt
... race, origin, age, and part-time status, the small- business workforce differs from the large -business workforce Brian Headd is an economist with the Office of Advocacy, U.S. Small Business Administration, Washington, ... represent the views of the Office of Advocacy. Brian Headd 14 Monthly Labor Review April 2000 Small- Business Employees establishments c...
Ngày tải lên: 17/02/2014, 21:20
Tài liệu U. S. Small Business Administration Table of Small Business Size Standards Matched to North American Industry Classification System Codes pdf
... Rail, and Water Transportation Equipment Rental and Leasing $7.0 532412 Construction, Mining and Forestry Machinery and Equipment Rental and Leasing $7.0 532420 Office Machinery and Equipment ... Photographic and Photocopying Equipment Manufacturing 1,000 333318 Other Commercial and Service Industry Machinery Manufacturing 1,000 333413 Industrial and Commercia...
Ngày tải lên: 22/02/2014, 05:20
U. S. Small Business Administration Table of Small Business Size Standards Matched to North American Industry Classification System Codes pot
... Standards in millions of dollars Size standards in number of employees 423910 Sporting and Recreational Goods and Supplies Merchant Wholesalers 100 423920 Toy and Hobby Goods and ... Rail, and Water Transportation Equipment Rental and Leasing $30.0 532412 Construction, Mining and Forestry Machinery and Equipment Rental and Leasing $30.0 532420 O...
Ngày tải lên: 07/03/2014, 01:20
The Financing of Small Business pot
... elderly and disabled (Allen and Truman, 1991; Carter and Cannon, 1992; Clark and James, 1992; Roberts-Reid and Curran, 1992). This may explain why around 50 per cent of women set up and run their businesses ... (Carter and Cannon, 1992; Clark and James, 1992; Roberts-Reid and Curran, 1992) and why they spend fewer hours in their businesses than men (Allen and Truman, 1...
Ngày tải lên: 07/03/2014, 19:20
handling and preservation of fruits and vegetables by combined methods for rural areas potx
Ngày tải lên: 08/03/2014, 12:20
Six Deadly Small Business Marketing Mistakes by David Frey pdf
... products and services. These are some examples of complimentary product or service businesses that can take advantage of this powerful strategy: Pizza place and video rental store Accountant and financial ... rental store Accountant and financial planner Toy store and fast food restaurant Dry cleaner and clothing store Paint store and tile business Jewelry store and wedd...
Ngày tải lên: 14/03/2014, 19:20
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... DNA and R uvA at 1 0 n M (lanes b and d) or 100 n M (lanes c and e). (C) Surface plasmon resonance sensorgram sho wing binding of EcRuvA (8 l M ) to duplex, three-strand and Holliday junction DNA. ... CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand 4 and a 37-bp duplex DNA by annealing oligonucleotides 5 (bio-AATGCTA CAGTATCGTCCGGTCACGTACAAC...
Ngày tải lên: 17/03/2014, 17:20