Case Study in Financial Modeling and Simulation of a Forestry Investment potx

Case Study in Financial Modeling and Simulation of a Forestry Investment potx

Case Study in Financial Modeling and Simulation of a Forestry Investment potx

... risks and product types are particular to forestry.  Modeling helps to analyze the forecast values. 1 Chapter 10: Case Study in Financial Modeling and Simulation of a Forestry Investment Investment ... model. 4 Key Parameters in Forestry Models  Establishment:- land, land preparation, plant stock, planting, watering.  Maintenance:- weed control, fertilizi...

Ngày tải lên: 23/03/2014, 04:20

18 786 4
Modeling and Simulation of Microbial Depolymerization Processes of Xenobiotic Polymers

Modeling and Simulation of Microbial Depolymerization Processes of Xenobiotic Polymers

... enzy- matic degradation of PVA was applied to enzymatic degradation of polylactic acid ( PLA ), and the degradability of PVA and PLA was compared [17] . Dependence of degradation rate on time was ... that represents the degradation rate and an initial condition, it forms an initial value problem of a linear partial differential equation. On the other hand, given the ini...

Ngày tải lên: 25/10/2013, 08:20

26 522 0
A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy

A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy

... gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation with heparin and warfarin was required. Spontaneous rupture of the mem- branes, leading ... small-for-dates babies. A large French study of women with pre-existing renal damage reported a prematurity rate of 17 per cent and a spontaneous abortion rate (miscar...

Ngày tải lên: 01/11/2013, 08:20

6 512 0
modeling and simulation of systems using matlab and simulink

modeling and simulation of systems using matlab and simulink

... design engineering, and Prof. Shesha Jayaram, High Voltage Lab, University of Waterloo, Ontario, Canada; and S. Krishnananda at the Dayalbagh Educational Institute, Agra, Uttar Pradesh, India, for ... national and international research collaborations in the area of modeling and simulations, soft computing, intelligent adaptive control systems, and optimization. He has a...

Ngày tải lên: 01/04/2014, 10:55

734 1,3K 0
Design and Simulation of A CMOS-MEMS Accelerometer

Design and Simulation of A CMOS-MEMS Accelerometer

... ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a total sensing capacitance of 60fF. Parasitic capacitance and mismatch of ... sensitivity can be obtained by increasing effective mass, and modulation voltage, or by reducing spring constant, finger gap, and the ratio of parasitic capacitance and sensing...

Ngày tải lên: 27/10/2013, 23:15

40 589 1
Tài liệu Design And Simulation Of A Cmos-Mems Accelerometer doc

Tài liệu Design And Simulation Of A Cmos-Mems Accelerometer doc

... capacitance and smaller leakage current. The main trade-offs in preamplifier design are to achieve reasonable gain boost, minimize thermal noise, and limit bandwidth, while keeping reasonable settling ... the drains of input pairs from output nodes, and keep drain nodes tracking the input, thus minimize effective input capacitance. A V gs-eff of 0.25V, and a bias current I d...

Ngày tải lên: 22/12/2013, 08:16

40 581 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... 5¢-GAATTC ATGCTACTAGTAAAT CAG-3¢ (number 1) and downstream primer with a sequence complementary to the 5¢ end of poneratoxin gene and 3¢ end of a signal peptide: 5¢-CAGAAGCGGAA GAAA GCATGCAAAGGCAGA-3¢ ... forward 5¢- 2 GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used to synthesize the N-terminal frag...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

Báo cáo khoa học: In vitro selection and characterization of a stable subdomain of phosphoribosylanthranilate isomerase potx

... of trPRAI-His The far-UV and near-UV CD spectra of trPRAI-His were recorded and analyzed in a manner identical with those for PRAI and FLAG-PRAI (vide supra). In addi- tion, the thermal melting ... and near-UV CD spectra of PRAI and FLAG-PRAI in a buffer in which PRAI retains catalytic activity (Fig. 3). The spectra are effectively superimposable in both cases. T...

Ngày tải lên: 30/03/2014, 20:20

14 382 0
Status and changes of mangrove forest in Mekong Delta: Case study in Tra Vinh, Vietnam

Status and changes of mangrove forest in Mekong Delta: Case study in Tra Vinh, Vietnam

... Status and changes of mangrove forest in Mekong Delta: Case study in Tra Vinh, Vietnam Phan Minh Thu a, * , Jacques Populus b a Institute of Oceanography, 01 Cau Da, Nha Trang, Khanh Hoa, Vietnam b IFREMER, ... 377e384. Lakshmi, A. , Rajagopalan, R., 2000. Socio-economic implications of coastal zone degradation and their mitigation: a case study from coastal villa...

Ngày tải lên: 14/08/2013, 14:15

12 742 1
w