Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

... Bienkowska-Haba7216 FEBS Journal 276 (2009) 7206–7216 ª 2009 The Authors Journal compilation ª 2009 FEBSMINIREVIEW Viral entry mechanisms: human papillomavirus and a long journey from extracellular ... the uronic acid and at the 3-O and 6-Oposition of the amino sugar. The amino group of the glucosamine may be either acetylated or sulfated. The two major families of cell surface HSPGs are the ... epitopes and encapsidated DNA for examination of the uncoatingof papillomaviral pseudoviruses has proven to be moresuccessful. An HA tag at the L2 C-terminus and bromodeoxyuridine-labeled viral...

Báo cáo khoa học: Viral entry mechanisms: the increasing diversity of paramyxovirus entry doc

... paramyxovirus family contains established human pathogens such as the measles virus and human respiratory syncytial virus, as well as emerg-ing pathogens including the Hendra and Nipah viruses and the ... peptideinto the target membrane and subsequent fusion of the viral and cellular membranes.Attachment proteins and receptorsFor the majority of paramyxoviruses, interaction of the attachment ... hemagglutinin-neuraminidase; hPIV3, human parainﬂuenza virus 3; HRA, heptad repeat A; HRB, heptad repeat B; hRSV, human respiratory syncytial virus; N, neuraminidase; NDV,Newcastle Disease virus; PIV5, parainﬂuenza...

Báo cáo khoa học: Viral entry mechanisms: cellular and viral mediators of herpes simplex virus entry potx

... proteins and receptors, leading to penetrationof the viral nucleocapsid and tegument proteins into the cytoplasm. The nucleocapsid is then transported to the nuclear membrane and the viral DNA is ... toward the nuclear membrane for uncoating and the release of viral DNA into the nucleus. Transcription, replicationof viral DNA and assembly of progeny capsids takeplace within the host nucleus. The ... release of the viral nucleocapsid proximal to the nucleus. J. Akhtar and D. Shukla Cellular and viral mediators of HSV entry FEBS Journal 276 (2009) 7228–7236 ª 2009 The Authors Journal compilation...

Báo cáo khoa học: Differential binding of human immunoagents and Herceptin to the ErbB2 receptor ppt

... the Scatchard analysis of the binding data. The calculated constants from these plots (KD1 and KD2) are listed in Table 2.Table 2. Afﬁnity and rate constants for ErbB2-ECD ⁄ ligand interactions ... non-linear analysis of the association and dissociation curves using SPR kinetic evaluation soft-ware (package BIAevaluation 3.2, Biacore AB), ﬁtting data to the 1 : 1 Langmuir binding model. Values ... the ﬂow cell surfaces.Surface plasmon resonance was also employed to carry outequilibrium binding analyses of Herceptin and ERB-hcAb,as bivalent analytes, and ERB-hRNase, as a monovalentanalyte,...

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... ACTCAAGGGATTGTAGCCTTCCGGCAGCATCTACAGAATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAGGAACCCCTTGGTCCTCGCGAGATTCTGTAGATGCTGCCGGAAGGCTACAATCCCTTGAGTGAGAGACGTATC and 5¢-GATACGTCCCTTACACAAGGACTTAAGGCATTTAGACAACAGCTTCGGAAGAATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAATCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTGTCTAAATGCCTTAAGTCCTTGTGTAAGGGACGTATC, ... 5¢-GCGAGGACCAAGGGGATTCTGGAGCTGAACAAGGTGCAATTGTTGTACGAACAGGTGTGCCAGTCCTCC/5¢-GGAGGACTGGCACACCTGTTCGTACAATAATTGCACCTTGTTCAGCTCCAGAATCCCCTTTGGCCTCGC and 5 ¢-CTTGCTAGAACCAAAGGATTTCTGGGGTTGAACAAAATAAAAGGGCTGGCTCGGCAAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTGATCCCATTTGTCGAGC CAGCCCTTTTATTTTGTTCAACCCCAGAAATCCTTTGGTTCTAGCAAG. The ... 5¢-AAAGGATCCGTGGGCTTTTACGACGTGGA; 163F: 5¢-AAAGGATCCATCAAGCTGGCAGATTTTGGA; 342F: 5¢-AAAGGATCCGAGCGCCTCAGGGAGCATCGA; 571F: 5¢-AAAGGATCCCAGGAGGGACGGAGAGCG; 632F: 5 ¢-AAAGGATCCCCGGCCCCAAGCTCAGGTCTG; the BamHI site...

Báo cáo khoa học: Unusual stability of human neuroglobin at low pH – molecular mechanisms and biological signiﬁcance docx

... Mb and Ngb and the comparison of A BCDFig. 2. CD characterization of Ngb and Mb at neutral and acidic pH. (A) Far-UV CD spectra of human holoNgb and apoNgb dissolved in20 mM Tris ⁄ HCl and ... 520–523.2 Kawada N, Kristensen DB, Asahina K, Nakatani K,Minamiyama Y, Seki S & Yoshizato K (2001) Charac-terization of a stellate cell activation-associated protein(STAP) with peroxidase activity ... between the maximum at 287 nm and the minimum at283 nm and that between the maximum at 287 nm and the mini-mum at 295 nm were used to calculate the Tyr exposure.Unusual acid stability of human...

Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx

... identiﬁed.Although calpain 7 contains a C2-like domain, it lacks a penta-EF-hand domain and is classiﬁed as an atypicalcalpain. As one of the signiﬁcant structural features,mammalian calpain 7 ... (forward, 5¢-TAGGATCCCCTGGACCCAAGCCAGAAG-3¢; reverse, 5¢-AGAGAATTCTGCCTGGTTTAAGAGACC-3¢; restriction sitesunderlined) and pCMV3xFLAG–IST1 as a template. The ampliﬁed cDNA fragment was ﬁrst ... (Chiba,Japan), using a pair of primers (forward, 5¢-CTAGAATTCAACAGCACAGCATGCTGG-3¢; reverse, 5¢-AGAGAATTCTGCCTGGTTTAAGAGACC-3¢; restriction sitesunderlined). The ampliﬁed cDNA fragment was...

Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efﬁcient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

... ADP. On the other hand, the large difference in phosphate donorcapacity, only 4% with ADP and no activity withNaPPP and NaPP, indicates that the base part of the phosphate donor must play an ... nucleotides. The results are presented in Table 1 and show that the inorganic polyphosphates are notable to act as phosphate donor. This also shows thatphosphate donor capacity and the tetramerizationeffect ... is due to the inhibi-tory effect of AMP in the assay. The average massof the eight tetrameric hTK1s was estimated as103.7 ± 3.2 (SEM) kDa (Table 1).Are the oligomerization pattern and kineticsrelated?The...

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... adenocarcinomasAnna Maria Luciani1, Sveva Grande1, Alessandra Palma1, Antonella Rosi1, Claudio Giovannini2,Orazio Sapora3, Vincenza Viti1 and Laura Guidoni11 Dipartimento di Tecnologie ... software (OriginLab Corp.,Northampton, MA, USA).Statistical analysisStudent’s t-test was applied to the two-sample groups to compare variations in intensity of the control and irradi-ated samples. ... proceed towards the S and G2 phases while trying to repair the dam-aged DNA, with a subsequent block in the G2 phase,at the expense of G1 (Fig. 4A ). On the other hand,HeLa cells undergo apoptosis...

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... (1999) Characterisation and mitochondrial localisa-tion of AUH, an AU-speciﬁc RNA-binding enoyl-CoAhydratase. Gene 228, 85–91.17 Nakagawa J & Moroni C (1997) A 20-amino-acidautonomous RNA-binding ... CoA-donor to a CoA-acceptor (Fig. 2). In addition to its natural sub-strate (R)-2-hydroxyglutarate, glutaconate CoA-trans-ferase uses glutaconate, 3-methylglutaconate and othershort chain carboxylic ... the main hydratase in the human leucine degradation pathway and that muta-tions leading to reduced hydratase activity are respon-sible for the MGA1 phenotype. The need to differentiate patients...

Xem thêm