Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf
Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf
... levelsduring the differentiation of fetal adipose tissues andwith the maturation of human primary adipocytes, suggesting that CIDEC might be a target of PPARctransactivation. These data suggest that ... Authors Journal compilation ª 2010 FEBS 4183 Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes Fanfan Li1,YuGu1, ... perilipin and were assessed using quantitative PCR. The resultsrevealed that the mRNA level of adipophilin was not changed, the mRNA levels of perilipin and FABP were decreased and the mRNA levelof...
- 11
- 513
- 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc
... sec-tions incubated with preadsorbed primary antiserum(Fig. 6B). The brown 3,3¢-diaminobenzidine (DAB)staining was granular and confined to the cytoplasm of the cells. Based on their size and shape the ... epithelial cells andvascular endothelial cells. These data suggest an important role for Cyp4x1 in the brain.AbbreviationsDAB, 3,3¢-diaminobenzidine; TCDD, 2,3,7,8 tetrachlorodibenzo-p-dioxin.936 ... RNA for RNAase protection assay. M indicates the 124-basepair marker transcript (M), the full-length probe is indicated by a line, and the protected fragment is indicated by an arrow. The RNAase...
- 12
- 466
- 0
Báo cáo khoa học: Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA potx
... 1 Plasmid constructs are derivatives of pDA3480 [9,10]. The 5¢ end of the transcript is 5¢-AAUUGUGAGCGGAUAACAAUUUCA-CCAGGUAAUAAAUUAAAUAAAAUUUAAAUAUG-3¢ for the gene variants that lack a functional ... expression in the cases of the arginine codons CGG and AGG, sucheffect is not observed for the other analysed argininecodons AGA, CGC, CGA and CGU. The amino acidsequence of the nascent peptide is the ... (encoding tRNAArg4), pArgUW(encoding tRNAArg4and tRNAArg5) and pMO22 (encoding tRNAGly1)as combined with +2, +3, +4, +5 or +7 AGG, GGG, AGA or AAA ateach indicated position in the 3A ...
- 11
- 510
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... interactor.Nucleolin was first described as a major nuclear pro-tein consisting of a negatively charged N-terminaldomain, an RNA-binding domain and a C-terminaldomain rich in RGG motifs [54]. Nucleolin has beenreported ... sig-nal. The low yields of the AP probe and of nucleolin,together with the inevitable partial degradation of nucleolin, mean that calculations of binding affinityare unrealistic at this stage.Nucleolin ... staining using nucleolin antibodyproduced a closely overlapping staining pattern to thatseen in the RAP assay, with most of the staininglocalized to developing muscle (Fig. 4B). Increasedmagnification...
- 14
- 669
- 0
Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx
... YokogawaT, Okuni T, Nakayama H, Takio K, Yabuki T, KigawaT, Kodama K, Yokogawa T, Nishikawa K &Yokoyama S (2002) An unnatural base pair for incor-porating amino acid analogs into proteins. ... incorporation of unnatural amino acids, havetaken advantage of advances in cell- free translationsystems. The use of tRNA, mischarged with an un-natural amino acid through a chemical acylationmethod ... use of engineered aminoa-cyl-tRNA synthetases [38,39] and ribozymes [40] thatcan catalyze aminoacylation of tRNA with specificunnatural amino acids. In addition to amber codons,other target codons...
- 8
- 611
- 0
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
... CCTTTGAGCACATTTCGGCAA-3¢P450 aromatase 5¢-1555GCTTCTCATCGCAGAGTATCCGG-3¢ 2895¢-1821CAAGGGTAAATTCATTGGGCTTGG-3¢b-actin 5¢-2350 ACAGACTACCTCATGAAGAT-3¢ 6655¢-3222 AGCCATGCCAAATGTCTCAT-3¢Fig. 1. Dose-related ... CT, USA).DNA quanti®cation The DNA content of the cell layer at the end of incubationwas quanti®ed by the method of West et al .[31].Aftersolubilization of the cell layer in 1MNaOH and s ... AGGTGCTTTGCCAGATATGACT-3¢ 4325¢-802 CTCTTTGATGACAGAAGTGCCT-3¢Syndecan-4 5¢-85 GAGTCGATTCGAGAGACTGA-3¢ 3655¢-450 AAAAATGTTGCTGCCCTG-3¢Glypican-1 5¢-566 GAATGACTCGGAGCGTACACTG-3¢ 4885¢-1054 CCTTTGAGCACATTTCGGCAA-3¢P450...
- 10
- 624
- 0
Báo cáo khoa học: Cell biology, regulation and inhibition of b-secretase (BACE-1) potx
... 1743–1752.36 Harada H, Tamaoka A, Ishii K, Shoji S, Kametaka S,Kametani F, Saito Y & Murayama S (2006) Beta-siteAPP cleaving enzyme 1 (BACE1) is increased in remaining neurons in Alzheimer’s disease ... diagram of the alternative processing pathways of APP. The transmembraneAPP undergoes two alternative and competing pathways of metabolism. The major and non-amyloidogenic, or a- secretase, pathwayprecludes ... within APP, andconcluded that the cleavage may be carried out by anaspartic protease. They subsequently searched the database of the newly emerging Caenorhabditis elegansgenome using the characteristic...
- 15
- 439
- 0
Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt
... GCTTTGTTCGTGCAAATTTCC 55 35CTGCAAATATCTCTGGGAAGATRPC5 CAGCATTGCGTTCTGTGAAAC 55 35CAGAGCTATCGATGAGCCTAACTRPC6 GACATCTTCAAGTTCATGGTCATA 55 35ATCAGCGTCATCCTCAATTTCTRPC7 CAGAAGATCGAGGACATCAGC 55 ... (5¢-to3¢)AnnealingT (°C)CyclenumberActin TGTTGGCGTACAGGTCTTTGC 60 23GCTACGAGCTGCCTGACGGGAPDH TATCGTGGAAGGACTCATGACC 55 20TACATGGCAACTGTGAGGGGTSP1 CCGGCGTGAAGTGTACTAGCTA 65 25TGCACTTGGCGTTCTTGTTRPC1 ... 25TGCACTTGGCGTTCTTGTTRPC1 GATTTTGGAAAATTTCTTGGGATGT 55 35TTTGTCTTCATGATTTGCTATCATRPC2 CATCATCAT-GGTCATTGTGCTGC 55 35GGTCTTGGTCAGCTCTGTGAGTCTRPC3 GACATATTCAAGTTCATGGTCCTC 55 35ACATCACTGTCATCCTCAATTTCTRPC4...
- 13
- 609
- 0
Báo cáo khoa học: Cell-free protein synthesis ppt
... aretranslated by a complex mixture that contains ribo-somes and a full complement of initiation, elongationand termination factors, as well as a full set of amino-acyl-tRNA synthetases and other required ... other applications. In the E. colisystem programmed with plasmid DNA, the cell extract contains or is supplemented with an RNA po-lymerase to transcribe the gene, and the mRNAs aretranslated ... MINIREVIEW SERIES Cell- free protein synthesisNicholas E. DixonResearch School of Chemistry, Australian National University, Canberra, ACT, Australia Cell- free protein synthesis using cell...
- 2
- 216
- 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt
... protein wassubcellularly located mainly in the Golgi apparatus and at the plasmamembrane. Pulse–chase metabolic cell labelling studies revealed that GFP–PrPCwas initially synthesized as a 45-kDa ... 402–409.57 Beggah A, Mathews P, Beguin P & Geering K (1996)Degradation and endoplasmic reticulum retention of unassembled alpha- and beta-subunits of Na,K–ATPasecorrelate with interaction of BiP. ... mel-anophores resulting in darkening of the skin [23].POMC is the major cargo protein in this cell type andduring adaptation to a black background the amount of POMC mRNA is induced 30-fold, and...
- 16
- 431
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI