Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf

Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf

Báo cáo khoa học: Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in the differentiation of human adipocytes pdf

... levels during the differentiation of fetal adipose tissues and with the maturation of human primary adipocytes, suggesting that CIDEC might be a target of PPARc transactivation. These data suggest that ... Authors Journal compilation ª 2010 FEBS 4183 Cell death-inducing DFF45-like effector, a lipid droplet-associated protein, might be involved in...

Ngày tải lên: 23/03/2014, 03:20

11 513 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... sec- tions incubated with preadsorbed primary antiserum (Fig. 6B). The brown 3,3¢-diaminobenzidine (DAB) staining was granular and confined to the cytoplasm of the cells. Based on their size and shape the ... epithelial cells and vascular endothelial cells. These data suggest an important role for Cyp4x1 in the brain. Abbreviations DAB, 3,3¢-diaminobenzidine; TCDD, 2,3,7,8 tetrac...

Ngày tải lên: 19/02/2014, 07:20

12 466 0
Báo cáo khoa học: Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA potx

Báo cáo khoa học: Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA potx

... 1 Plasmid constructs are derivatives of pDA3480 [9,10]. The 5¢ end of the transcript is 5¢-AAUUGUGAGCGGAUAACAAUUUCA- CCAGGUAAUAAAUU AAAUAAAAUUUAAAUAUG-3¢ for the gene variants that lack a functional ... expression in the cases of the arginine codons CGG and AGG, such effect is not observed for the other analysed arginine codons AGA, CGC, CGA and CGU. The amino acid seq...

Ngày tải lên: 30/03/2014, 20:20

11 510 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... interactor. Nucleolin was first described as a major nuclear pro- tein consisting of a negatively charged N-terminal domain, an RNA-binding domain and a C-terminal domain rich in RGG motifs [54]. Nucleolin has been reported ... sig- nal. The low yields of the AP probe and of nucleolin, together with the inevitable partial degradation of nucleolin, mean that calculations...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx

Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx

... Yokogawa T, Okuni T, Nakayama H, Takio K, Yabuki T, Kigawa T, Kodama K, Yokogawa T, Nishikawa K & Yokoyama S (2002) An unnatural base pair for incor- porating amino acid analogs into proteins. ... incorporation of unnatural amino acids, have taken advantage of advances in cell- free translation systems. The use of tRNA, mischarged with an un- natural amino acid through a chem...

Ngày tải lên: 19/02/2014, 06:20

8 612 0
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx

Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx

... CCTTTGAGCACATTTCGGCAA-3¢ P450 aromatase 5¢-1555GCTTCTCATCGCAGAGTATCCGG-3¢ 289 5¢-1821CAAGGGTAAATTCATTGGGCTTGG-3¢ b-actin 5¢-2350 ACAGACTACCTCATGAAGAT-3¢ 665 5¢-3222 AGCCATGCCAAATGTCTCAT-3¢ Fig. 1. Dose-related ... CT, USA). DNA quanti®cation The DNA content of the cell layer at the end of incubation was quanti®ed by the method of West et al .[31].After solubilization of the...

Ngày tải lên: 21/02/2014, 03:20

10 625 0
Báo cáo khoa học: Cell biology, regulation and inhibition of b-secretase (BACE-1) potx

Báo cáo khoa học: Cell biology, regulation and inhibition of b-secretase (BACE-1) potx

... 1743–1752. 36 Harada H, Tamaoka A, Ishii K, Shoji S, Kametaka S, Kametani F, Saito Y & Murayama S (2006) Beta-site APP cleaving enzyme 1 (BACE1) is increased in remaining neurons in Alzheimer’s disease ... diagram of the alternative processing pathways of APP. The transmembrane APP undergoes two alternative and competing pathways of metabolism. The major and non-amyloidog...

Ngày tải lên: 07/03/2014, 00:20

15 439 0
Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt

Báo cáo khoa học: Transient potential receptor channel 4 controls thrombospondin-1 secretion and angiogenesis in renal cell carcinoma ppt

... GCTTTGTTCGTGCAAATTTCC 55 35 CTGCAAATATCTCTGGGAAGA TRPC5 CAGCATTGCGTTCTGTGAAAC 55 35 CAGAGCTATCGATGAGCCTAAC TRPC6 GACATCTTCAAGTTCATGGTCATA 55 35 ATCAGCGTCATCCTCAATTTC TRPC7 CAGAAGATCGAGGACATCAGC 55 ... (5¢-to3¢) Annealing T (°C) Cycle number Actin TGTTGGCGTACAGGTCTTTGC 60 23 GCTACGAGCTGCCTGACGG GAPDH TATCGTGGAAGGACTCATGACC 55 20 TACATGGCAACTGTGAGGGG TSP1 CCGGCGTGAAGTGTACTAGCTA 65 25 TGCACTTGGC...

Ngày tải lên: 07/03/2014, 05:20

13 610 0
Báo cáo khoa học: Cell-free protein synthesis ppt

Báo cáo khoa học: Cell-free protein synthesis ppt

... are translated by a complex mixture that contains ribo- somes and a full complement of initiation, elongation and termination factors, as well as a full set of amino- acyl-tRNA synthetases and other required ... other applications. In the E. coli system programmed with plasmid DNA, the cell extract contains or is supplemented with an RNA po- lymerase to transcribe the gene...

Ngày tải lên: 16/03/2014, 13:20

2 216 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

... protein was subcellularly located mainly in the Golgi apparatus and at the plasma membrane. Pulse–chase metabolic cell labelling studies revealed that GFP– PrP C was initially synthesized as a 45-kDa ... 402–409. 57 Beggah A, Mathews P, Beguin P & Geering K (1996) Degradation and endoplasmic reticulum retention of unassembled alpha- and beta-subunits of Na,K–ATPase correlat...

Ngày tải lên: 16/03/2014, 14:20

16 431 0
w