Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

... a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response Hao Huang*, Sheng-Dong Qi*, Fang Qi, Chang-Ai Wu, Guo-Dong Yang ... that NtKTI1 exerted prominent antifungal activity towards R. solani and moderate antifungal activity against Rhizopus nigricans and Phytophthora parasiti...

Ngày tải lên: 23/03/2014, 03:20

... purified apoprotein with trypsin (T) and Asp-N endo- proteinase (D), and of native protein with Glu-C endoproteinase (S). Amino acids identified by Edman degradation and MS tandem fragmen- tation are ... translation [28]. The GTPase has an OB domain at the N-terminus and a zinc-finger domain at the C-terminus which are involved in bind- ing. PCD is known to have two roles, as an en...

Ngày tải lên: 08/03/2014, 08:20

... Belgium thomas.francois@uclouvain.be Abstract Reading is known to be an essential task in language learning, but finding the ap- propriate text for every learner is far from easy. In this context, automatic ... lexical and syntactic variables Any text classification tasks require an object (here a text) to be parameterised into variables, whether qualitative or quantitative. These i...

Ngày tải lên: 08/03/2014, 21:20

Ngày tải lên: 09/03/2014, 01:20

... shown in Ta- ble 4. As expected, making supertag constraints hard (with a value of 0.0) over-constrains most parsing problems, so that hardly any analyses can be computed. Other values near 0 avoid ... obtain and evaluate supertag predictions, we used the NEGRA and TIGER corpora (Brants et al., 1997; Brants et al., 2002), automatically trans- formed into dependency format with the free...

Ngày tải lên: 23/03/2014, 18:20

... These receptors share common features: all contain seven transmembrane spanning domains and are coupled to G-proteins themselves anchored to the inner leaflet of the plasma membrane. In contrast ANP-induced ... is a significant increase in food intake, caused by the lack of a satiety signalling, whereas no change in food intake was detected in the B [a] P-treated animals. In addit...

Ngày tải lên: 30/03/2014, 11:20

... to the insoluble substrate. In addition to plants, a protein with an endoglucanase domain and a domain with sequence similarity to expansins has been reported in the plant pathogen Clavibacter michiganensis ... activities against HEC (Fluka) and barley b-glucan (Biocon) were determined according to IUPAC [26] and against birch xylan (Roth) as presented [27]. Mannanase activity...

Ngày tải lên: 31/03/2014, 09:20

... glycolysis and may therefore provide an additional layer of regulation. Second, specificity of protein degradation is also a plausible mechanism to explain our data. In general, not all proteins are ... mL. In this and earlier studies the fermentative capacity is measured as the rate of ethanol production in an off-line assay in which cells are transferred to a complete growth...

Ngày tải lên: 18/02/2014, 06:20

... Katayama H, Tominaga S, Takasuka T, Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005) Cloning and characterization of a molt-inhibiting hormone-like peptide from the prawn Marsupenaeus japonicus. ... Province, Thailand). Experiments involving animals were carried out in accor- dance with animal care and use protocol of the Mahidol University Animal Care and Use Committee (MUACUC)....

Ngày tải lên: 23/03/2014, 07:20

... GACTAGTTTAAACGGATCGACGAGTTCGACGC ppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGC ppsE3 CGTTCTGGAGCAACCTTCG ppsE4 GGTCGAGGAAGTACGTGAC res res1 GCTCTAGAGCAACCGTCCGAAATATTATAAA res2 GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATC Phthiocerol ... AGGAAGGCCGGCAAATGGC 2951D TTCACGTGAGATAAGCTCCC 2951E ACGGTTTCGGTGAAGCCAG 2951L ACAATTAATTAACAGTATGTACGAGCGATGCG 2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTG ppsE ppsE1 GACTAGT...

Ngày tải lên: 23/03/2014, 09:20