Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

... a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response Hao Huang*, Sheng-Dong Qi*, Fang Qi, Chang-Ai Wu, Guo-Dong Yang ... that NtKTI1 exerted prominent antifungal activity towards R. solani and moderate antifungal activity against Rhizopus nigricans and Phytophthora parasiti...

Ngày tải lên: 23/03/2014, 03:20

13 501 0
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

... purified apoprotein with trypsin (T) and Asp-N endo- proteinase (D), and of native protein with Glu-C endoproteinase (S). Amino acids identified by Edman degradation and MS tandem fragmen- tation are ... translation [28]. The GTPase has an OB domain at the N-terminus and a zinc-finger domain at the C-terminus which are involved in bind- ing. PCD is known to have two roles, as an en...

Ngày tải lên: 08/03/2014, 08:20

11 517 0
Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx

Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx

... Belgium thomas.francois@uclouvain.be Abstract Reading is known to be an essential task in language learning, but finding the ap- propriate text for every learner is far from easy. In this context, automatic ... lexical and syntactic variables Any text classification tasks require an object (here a text) to be parameterised into variables, whether qualitative or quantitative. These i...

Ngày tải lên: 08/03/2014, 21:20

9 514 0
Báo cáo khoa học: "Guiding a Constraint Dependency Parser with Supertags" pot

Báo cáo khoa học: "Guiding a Constraint Dependency Parser with Supertags" pot

... shown in Ta- ble 4. As expected, making supertag constraints hard (with a value of 0.0) over-constrains most parsing problems, so that hardly any analyses can be computed. Other values near 0 avoid ... obtain and evaluate supertag predictions, we used the NEGRA and TIGER corpora (Brants et al., 1997; Brants et al., 2002), automatically trans- formed into dependency format with the free...

Ngày tải lên: 23/03/2014, 18:20

8 276 0
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

... These receptors share common features: all contain seven transmembrane spanning domains and are coupled to G-proteins themselves anchored to the inner leaflet of the plasma membrane. In contrast ANP-induced ... is a significant increase in food intake, caused by the lack of a satiety signalling, whereas no change in food intake was detected in the B [a] P-treated animals. In addit...

Ngày tải lên: 30/03/2014, 11:20

11 425 0
Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

... to the insoluble substrate. In addition to plants, a protein with an endoglucanase domain and a domain with sequence similarity to expansins has been reported in the plant pathogen Clavibacter michiganensis ... activities against HEC (Fluka) and barley b-glucan (Biocon) were determined according to IUPAC [26] and against birch xylan (Roth) as presented [27]. Mannanase activity...

Ngày tải lên: 31/03/2014, 09:20

10 402 0
Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

... glycolysis and may therefore provide an additional layer of regulation. Second, specificity of protein degradation is also a plausible mechanism to explain our data. In general, not all proteins are ... mL. In this and earlier studies the fermentative capacity is measured as the rate of ethanol production in an off-line assay in which cells are transferred to a complete growth...

Ngày tải lên: 18/02/2014, 06:20

16 654 0
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

... Katayama H, Tominaga S, Takasuka T, Nakatsuji T, Sonobe T, Aida K & Nagasawa H (2005) Cloning and characterization of a molt-inhibiting hormone-like peptide from the prawn Marsupenaeus japonicus. ... Province, Thailand). Experiments involving animals were carried out in accor- dance with animal care and use protocol of the Mahidol University Animal Care and Use Committee (MUACUC)....

Ngày tải lên: 23/03/2014, 07:20

11 369 0
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc

... GACTAGTTTAAACGGATCGACGAGTTCGACGC ppsE2 GACTAGTTTAAACGAGGCACTGTGACCAGATGC ppsE3 CGTTCTGGAGCAACCTTCG ppsE4 GGTCGAGGAAGTACGTGAC res res1 GCTCTAGAGCAACCGTCCGAAATATTATAAA res2 GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATC Phthiocerol ... AGGAAGGCCGGCAAATGGC 2951D TTCACGTGAGATAAGCTCCC 2951E ACGGTTTCGGTGAAGCCAG 2951L ACAATTAATTAACAGTATGTACGAGCGATGCG 2951M ACAAAAGCTTGGCGCAAATCATAGCTTCTTG ppsE ppsE1 GACTAGT...

Ngày tải lên: 23/03/2014, 09:20

13 537 0
w