Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx
Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx
... is downregulated in estrogen receptor a- positive human breast cancer cell lines and clinical samples Jianhua Xiong 1, *, Dianke Yu 2, *, Na Wei 1 , Hanjiang Fu 3 , Tianjing Cai 1 , Yuanyu Huang 1 , ... strand 5¢-UCAUCGCAUUCC UUGCAAAdTdT-3 ¢, antisense strand 5¢- UUUGCAAGGAAUGCGAUGAdTdT-3¢;ERa siRNA #3 sense strand 5¢- GGAGAAUGUUGAAACA CAAdTdT-3¢, antisense strand 5...
Ngày tải lên: 22/03/2014, 21:20
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf
... VanBrocklin M, McWilliams MJ, Leppla SH, Duesbery NS & Woude GF (2002) Apoptosis and melanogenesis in human melanoma cells induced by anthrax lethal factor inactivation of mitogen-activated protein ... An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy Mogridge Department...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc Antisense ARS with PstI and SalI gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG TOP ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG TOP Ccttctccccggcggttagtgctgagagtgc ARS aaaaaatcc...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia histone methylases play critical roles in estrogen-mediated regulation of HOXC13 docx
... GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTG HOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCC HOXC13-ERE2 ... TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGAT HOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAA HOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... that OMM-64 is contained in the HMW aggregate, which may comprise proteins and heparan sulfate glycosaminoglycan chains, although the structures of the proteins and the glycosaminogly- can chains ... blotting using anti-rOMM-64 and anti-rOtolin-1 antisera was also performed. When the affinity beads were incubated with saccular extract, OMM-64 (arrows) and otolin-1 (arrowheads) boun...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... (Figs 3A and 5A) . A B Fig. 2. Decreased expression of heme oxygenase (HO)-1 and HO-2 under hypoxia in human cancer cells. (A) Northern blot analysis of HO-1 and HO-2 mRNA. HeLa cervical cancer and ... Kaneko 1 , Yuanying Ding 1 , Kazuhiro Ogawa 2, *, Miki Yoshizawa 1 , Masaki Kawamura 1 , Kazuhisa Takeda 1 , Tadashi Yoshida 3 and Shigeki Shibahara 1 1 Department of Molec...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: "An API for Measuring the Relatedness of Words in Wikipedia" docx
... path between computer and key- board in the English Wikipedia. provides multilingual support for the English, Ger- man, French and Italian Wikipedias and can be eas- ily extended to other languages 4 . 4 ... use- ful in many NLP applications such as word sense disambiguation (Kohomban & Lee, 2005; Patward- han et al., 2005), information retrieval (Finkelstein et al., 2002), info...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "An Approximate Approach for Training Polynomial Kernel SVMs in Linear Time" doc
... Science and Information Engineering National Central University National Central University Ming Chuan University Taoyuan, Taiwan Taoyuan, Taiwan Taoyuan, Taiwan bcbb@db.csie.ncu.edu.tw yang@cl.ncu.edu.tw ... and Marquez, 2003), shallow parsing (Kudo and Matsumoto, 2001, 2004; Lee and Wu, 2007), named entity recognition (Isozaki and Kazawa, 2002), and parsing (Nivre et al.,...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... subunit, and in accordance with the binding change mechanism [3], this arrangement suggests a catalytic mechanism in which the c subunit rotates within the a 3 b 3 cylinder. Elegant experiments have ... 8.0, containing 5mm EDTA and 1% (w ⁄ v) N-lauroylsarcosine for 10 min at 65 °C. After ultracentrifugation at room temperature, the pellet was discarded and contaminating membrane...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... used: anti-ADAM10, a polyclonal rabbit antibody against endogenous ADAM10 and anti-TACE, and a polyclonal rabbit antibody against endogenous TACE (Chemikon International, Temecula, CA). Both antibodies ... the ADAM (a disintegrin and metalloproteinase) family of type I membrane proteins and mediates the ectodomain shedding of various membrane- anchored signaling and adhesion pr...
Ngày tải lên: 08/03/2014, 02:20