Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals pptx

... Sputum cellularity in pulmonary tuberculosis: A comparative study between HIV-positive and -negative individuals Rosemeri Maurici da Silva 1 *, Paula Stocco 1 , Maria Luiza Bazzo 2 and ... Santos and collaborators, comparing data between 2001 and 2003 with data between 1991 and 1993, in a city of the state of Santa Catarina, has shown an inc...

Ngày tải lên: 22/03/2014, 18:20

... certain that Cor Pulmonale exists as a comp- lication in tuberculous individuals. Diagnosis based on clinical examination and radiology is not always easy, and a large proportion of cases are ... chronic inflammatory process, leading to impaired gas exchange, and also, interference with the normal rhythmic changes in pulmonary vascular capacity and pressure secon- dary...

Ngày tải lên: 22/03/2014, 18:20

... ribosome-binding site, and 5¢-GCAAGCTTTCATGGCAGTGAGCCTACG AGCCG-3¢ containing a HindIII restriction site. For the His 6 -tagged bioA gene, the primers were the following: 5¢- CGCGCGAATTCAGGAGGAATTTAAAATGCACCAC CACCACCACCACGCTGCGGCGACTGGCG-3¢ ... 5¢- CGCGCGAATTCAGGAGGAATTTAAAATGCACCAC CACCACCACCACGCTGCGGCGACTGGCG-3¢ contain- ing an EcoRI restriction site, a ribosome-binding site and a...

Ngày tải lên: 07/03/2014, 11:20

... Abstract Machine Translation (MT) need not be confined to inter-language activities. In this paper, we discuss inter-dialect MT in general and Cantonese-Mandarin MT in particular. Mandarin ... Cantonese and Chinese Mandarin. 1 Dialects and Chinese Dialects Dialects of a language are that language's systematic variations, developed when people of a common languag...

Ngày tải lên: 23/03/2014, 19:20

... manu- script and made critical revision to the paper. THZ and XHL performed data collection and analysis and helped to draft the manuscript. YPZ participated in the data collection, analysis and ... postgraduate study or going abroad. But, I am behind in my study and can not do anything. I am so worried.' (Female, 22 years old, intensive phase, inpatient) 'Since...

Ngày tải lên: 15/02/2014, 12:20

... cough. A study case was defined as a patient who presented a delay in initiating treatment and a control as a patient who did not present a delay in initiating treatment. For purposes of the analysis, ... first, a multivariate regression analysis was undertaken in each group, starting with a minimal model and adding one variable at a time. Variables associated to...

Ngày tải lên: 06/03/2014, 04:20

... examined by routine smear microscopy, culture and PCR. The data were compared with available clinical information. Radiological data was available from 61 subjects. The study was conducted blind. Quality ... Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical Mycobacteria. Statistical analysis As no single gold standard was available for comparis...

Ngày tải lên: 06/03/2014, 04:20

... central participant is the Sayer – the participant saying, telling, stating, informing, asking, demanding, offering, threatening, suggesting and so on, The Sayer can be a human or human-like ... Because of its earlier foundation, traditional grammar has largely influenced on linguistics in general and on language teaching in particular in several parts of the world, including...

Ngày tải lên: 07/09/2013, 13:48

... 1 MINISTRY OF EDUCATION AND TRAINING MINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAINING MINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG NGUYỄN XUÂN QUANG ... First, all the Vietnamese data and the American data were tabulated separately. Second, the trends in each group of data for each social factor of age, as well as social status and...

Ngày tải lên: 26/11/2013, 13:16