Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot
... The proapoptotic member of the Bcl-2 family
Bcl-2 / E1B-19K-interacting protein 3 is a mediator of
caspase-independent neuronal death in excitotoxicity
Zhengfeng Zhang
1,2
, Ruoyang Shi
1
, ... Bcl-2 family, including Bad, Bax, Bid,
and Bim, permeabilize mitochondrial membranes [ 13] .
Bcl-2 ⁄ E1B-19K-interacting protein 3 (BNIP3) is a...
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... GCGGCCGCCACCATGCATCATCACCATCAC
CATGTCAGCCGTTTTGAACAC
RPE65c-His-Fwd
NM_0011 136 53 GCGGCCGCCACCATGCATCATCACCATCAC
CATGTCAGCCGTCTTGAACAC
Y. Takahashi et al. A novel isomerohydrolase in the retina
FEBS ... that there is
an alternative isomerase in the retina of cone-dominant
species, likely in retinal Mu
¨
ller cells [33 ,34 ]. In the
present study, we report the clon ing...
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx
... antagoniz-
ing cell shrinkage may be a general feature of
apoptosis. For example, renal tubular epithelial cell
apoptosis was accompanied by a caspase-dependent
cleavage of the Na
+
⁄ H
+
exchanger ... phosphorylation of CD95 on
Tyr 232 and Tyr291 by the EGF-receptor tyrosine
kinase activity [15]. Although the appearance of CD95
at the plasma membrane was associated with...
Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc
... with a
functional blocking antibody to b
1
. These findings may
explain why bisecting GlcNAc-containing N-glycans
are abundant in the brain [65]. In fact, mice carrying
an inactive GnT-III mutant ... (1997)
Isolation, characterization and inactivation of the
mouse Mgat3 gene: the bisecting N-acetylglucosamine
in asparagine-linked oligosaccharides appears dispens-
able for viabi...
Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt
... monitoring of acute and chronic in ammation in
mammalian brain tissue both in vitro and in vivo,
including in the detection of cerebral malaria.
Retooling of this reporter system also allowed ... versatility and general applica-
tion to modified protein (glycoprotein) synthesis.
Chemical strategies in glycoprotein
synthesis
The chemical attachment of glycans offers an...
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... rotational
mechanism of the ring. The c ring of I. tartaricus has
11 negative charges that are equally distributed along
the horizontal axis of the rotor [8]. A positive charge
on the stator attracts ... F
1
F
0
ATP syntheses.
This low H
+
(Na
+
) ⁄ ATP ratio is apparently the reason
for the inability of eukaryal V
1
V
0
ATPases to catalyze
ATP synthesis in vivo [1...
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx
... concentration. Our new identification of the major
dihydroxyvitamin D3 product as 20, 23- dihydroxyvitamin D3, rather than
20,22-dihydroxyvitamin D3, explains why there is no cleavage of the vita-
min ... action of
P450scc, as well as the products that they gave rise to.
This revealed both the major and minor pathways for
the metabolism of vitamin D3 by P450scc.
Results
Met...
Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx
... other
members of the TGF-b family, binding to and inhibit-
ing these signaling molecules from binding to their
receptors in the extracellular space, thus inhibiting ven-
tralizing activities. Of these proteins, ... Chordin along the dorsoventral
axis.
Other aspects of BMP signaling, besides dorsoventral
patterning, are reported. BMP signaling is involved in
endodermal patte...
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx
... FEBS
and alkali extraction might not always be a reliable
indicator of whether a protein is integral in the outer
membrane [17,20–22].
As a distinct means to separate integral and peri-
pheral ... that while most of the protein
components are integral in the membrane, most of these mitochondrial pro-
teins behave as if they have a- helical transmembrane domains, r...
Tài liệu Báo cáo khoa học: "An Experiment in Evaluating the Quality of Translations" pdf
... it is not every machine that is re-
ferred to as an automatic machine I 8.67 1 .33 10.00 4 .33
II 9.00 1 .33 10 .33 5 .33
5. Machine:
However, by far not every machine is called
automatic machine ...
Translation No. 5: a machine translation (Machine
Program A)
Translation No. 7: a machine translation (Machine
Program B, 2d Pass)
Translation No. 9: a machine translation...