Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot
... The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity Zhengfeng Zhang 1,2 , Ruoyang Shi 1 , ... Bcl-2 family, including Bad, Bax, Bid, and Bim, permeabilize mitochondrial membranes [ 13] . Bcl-2 ⁄ E1B-19K-interacting protein 3 (BNIP3) is a...
Ngày tải lên: 22/03/2014, 17:20
... GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_0011 136 53 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi et al. A novel isomerohydrolase in the retina FEBS ... that there is an alternative isomerase in the retina of cone-dominant species, likely in retinal Mu ¨ ller cells [33 ,34 ]. In the present study, we report the clon ing...
Ngày tải lên: 14/02/2014, 14:20
... antagoniz- ing cell shrinkage may be a general feature of apoptosis. For example, renal tubular epithelial cell apoptosis was accompanied by a caspase-dependent cleavage of the Na + ⁄ H + exchanger ... phosphorylation of CD95 on Tyr 232 and Tyr291 by the EGF-receptor tyrosine kinase activity [15]. Although the appearance of CD95 at the plasma membrane was associated with...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Branched N-glycans regulate the biological functions of integrins and cadherins doc
... with a functional blocking antibody to b 1 . These findings may explain why bisecting GlcNAc-containing N-glycans are abundant in the brain [65]. In fact, mice carrying an inactive GnT-III mutant ... (1997) Isolation, characterization and inactivation of the mouse Mgat3 gene: the bisecting N-acetylglucosamine in asparagine-linked oligosaccharides appears dispens- able for viabi...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Chemical approaches to mapping the function of post-translational modifications ppt
... monitoring of acute and chronic in ammation in mammalian brain tissue both in vitro and in vivo, including in the detection of cerebral malaria. Retooling of this reporter system also allowed ... versatility and general applica- tion to modified protein (glycoprotein) synthesis. Chemical strategies in glycoprotein synthesis The chemical attachment of glycans offers an...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... rotational mechanism of the ring. The c ring of I. tartaricus has 11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive charge on the stator attracts ... F 1 F 0 ATP syntheses. This low H + (Na + ) ⁄ ATP ratio is apparently the reason for the inability of eukaryal V 1 V 0 ATPases to catalyze ATP synthesis in vivo [1...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx
... concentration. Our new identification of the major dihydroxyvitamin D3 product as 20, 23- dihydroxyvitamin D3, rather than 20,22-dihydroxyvitamin D3, explains why there is no cleavage of the vita- min ... action of P450scc, as well as the products that they gave rise to. This revealed both the major and minor pathways for the metabolism of vitamin D3 by P450scc. Results Met...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx
... other members of the TGF-b family, binding to and inhibit- ing these signaling molecules from binding to their receptors in the extracellular space, thus inhibiting ven- tralizing activities. Of these proteins, ... Chordin along the dorsoventral axis. Other aspects of BMP signaling, besides dorsoventral patterning, are reported. BMP signaling is involved in endodermal patte...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx
... FEBS and alkali extraction might not always be a reliable indicator of whether a protein is integral in the outer membrane [17,20–22]. As a distinct means to separate integral and peri- pheral ... that while most of the protein components are integral in the membrane, most of these mitochondrial pro- teins behave as if they have a- helical transmembrane domains, r...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: "An Experiment in Evaluating the Quality of Translations" pdf
... it is not every machine that is re- ferred to as an automatic machine I 8.67 1 .33 10.00 4 .33 II 9.00 1 .33 10 .33 5 .33 5. Machine: However, by far not every machine is called automatic machine ... Translation No. 5: a machine translation (Machine Program A) Translation No. 7: a machine translation (Machine Program B, 2d Pass) Translation No. 9: a machine translation...
Ngày tải lên: 19/02/2014, 19:20