Báo cáo khoa học: Identiﬁcation of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... sarcoma protein as a G-quadruplex DNA- and RNA-binding protein Kentaro Takahama1,*, Katsuhito Kino 2, *, Shigeki Arai3, Riki Kurokawa3and Takanori Oyoshi11 Department of Chemistry, Faculty ... (lanes 2, 4 and 6) and 32 P-labeled Htelo (lanes 3and 4), dsHtelo (lanes 5 and 6) or ssDNA S (lanes 1 and 2) . The structures of DNAs used as probes are indicated above each lane. The DNA protein ... TT) and KGG3 -2 reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers: KGG3-4 forward d(AGA CAA AGG TGG CTTCAA AGG...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC...

Tài liệu Báo cáo khoa học: Identiﬁcation of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3, 29 3– 320 . 2 Karalus R & Campagnari A (20 00) Moraxella catarrh-alis: a review of an important human ... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Moraxella catarrhalis andanalysis of a KdsA-deﬁcient isogenic mutant. InfectImmun 71, 6 426 –6434. 23 Edwards KJ, Allen S, Gibson BW & Campagnari AA (20 05) Characterization of a cluster of...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... P (20 00) The transcriptional co-activator P ⁄ CAF potenti-ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28 , 429 1– 429 8.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, ... U34596, DAD (Drosophila melanogaster DAD), AB00 423 2; dMAD(D. melanogaster MAD), U10 328 ; dMedea (D. melanogaster Medea), AF0571 62; dSmad2 (D. melanogaster Smad2), AF101386; EmSmadB(E. multilocularis ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al. (20 03) Transcriptome analysis of the acoelomate human parasite Schistosoma...

Tài liệu Báo cáo khoa học: Identiﬁcation, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 710– 728 RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822 –839RpCAbrR2 AGA GCA GCA GAC CTT ACG 706– 723 RpCAbrR3 ... 706– 723 RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483Probe ampliﬁcation for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 613–630RpCAbrR1 CGT AGC AGT ATC AGC AGT 822 –839RpCAtrFprobe TAC AAA GAT CCA ATC CAG C ... a wide range of eukaryotic organisms, they arealso widespread in the Archaea and Bacteria domains[11]. Among the broad range of physiological processesin which they participate, CA can play...

Tài liệu Báo cáo khoa học: Identiﬁcation of differentially expressed genes of the Paciﬁc oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 ... cells, kinase complex-associated protein AAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ACGGAGGTTGACGGGACTTGCTGGCACCACGATTGGDelta-9-desaturase ... GATACAGCAAACGGAAAGTCAACACAGTTCCTCGGGCCAACACystatin B GCCCCCCTCCCACACACATCTTCGGCCGTCTTTCCCTSL GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... Dyn 22 3, 427 –458. 22 Berver MM & Fekete DM (20 02) Atlas of the develop-ing inner ear in zebraﬁsh. Dev Dyn 22 3, 536–543. 23 Murayama E, Herbomel P, Kawakami A, Takeda H &Nagasawa H (20 05) ... HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 4 62, 22 5 22 9.5 Kono M, Hayashi N & Samata T (20 00) Molecularmechanism ... otolith matrix frameworkFEBS Journal 27 5 (20 08) 25 12 25 23 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 25 23 Identiﬁcation of a novel matrix protein contained in a protein aggregate associated...

Tài liệu Báo cáo khoa học: Identiﬁcation of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... N, Akihisa T, Tokuda H, Yasukawa K, Higashi-hara H, Ukiya M, Watanabe K, Kimura Y, HasegawaJ & Nishino H (20 04) Triterpene acids from the leaves of Perilla frutescens and their anti-inﬂammatory ... C -21 , C -22 ,and C -24 , whereas soyasapogenol B has three at C-3,C -22 , and C -24 [34]. In addition to these two agly-cones, soyasapogenols C and D (dehydrated or oxi-dized soyasapogenol B at the ... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from...

Tài liệu Báo cáo khoa học: Identiﬁcation of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... Consortium. Nat Genet 25 25 29 ], as shown on the legend. Most of the proteins fall into cel-lular fate and organization, followed by uncharacter-ized proteins.This material is available as part of the ... diacylglycerol kinase isozymes inrat ovary and placenta. Cell Tissue Res 320 , 525 –533.45 Banan A, Zhang LJ, Shaikh M, Fields JZ, ChoudharyS, Forsyth CB, Farhadi A & Keshaarzian A (20 05)Theta isoform ... tran-scriptional activation and translational modiﬁcationsnecessary to invoke various biological responses [3,4].Arguably the most notable of these cascades is the Janus kinase (Jak)-signal...

Tài liệu Báo cáo khoa học: Identiﬁcation of membrane-bound serine proteinase matriptase as processing enzyme of insulin-like growth factor binding protein-related protein-1 (IGFBP-rP1/angiomodulin/mac25) doc

... sense5¢-UCAUCACACUGAUAACCAACACUGA-AG-3¢; #25 78,sense 5¢-GGAUCAAAGAGAACACUGGGGUAUA-AG-3¢;and #1513 sense, 5¢-AGUUCACGUGCAAGAACAAGUUCUG-AG-3¢. The forward sequence of the scrambledRNA was 5¢-GAUCCAAGUAAUACAGAGAUGGGAGAG-3¢. ... synovial ﬂuid and interstitial ﬂuid, as well as culture media [24 ,25 ]. Several types of proteinases,such as pregnancy-associated plasma proteins [26 ,27 ],prostate speciﬁc antigen [28 ] and MMP-3 [29 ], ... plasminogen activator as substrates.J Biol Chem 27 5, 26 333 26 3 42. 34 Ihara S, Miyoshi E, Nakahara S, Sakiyama H, Ihara H,Akinaga A, Honke K, Dickson RB, Lin CY & Tanigu-chi N (20 04) Addition...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM