Báo cáo khoa học: Unique ganglioside binding by botulinum neurotoxins C and D-SA pdf

... in contributing to the coordina-tion of ganglioside binding by HCR ⁄ C and HCR ⁄ D-SA. Thus, HCR ⁄ C and HCR ⁄ D-SA utilize the GBLfor ganglioside binding. The GBLs of BoNT ⁄ C, BoNT ⁄ D and ... of HCR ⁄ C and HCR ⁄ D, but lacking a Trp. Ganglioside binding by HCR⁄ C and HCR⁄ D-SA Early studies showed that HCR ⁄ C bound GD1b and GT1b [46]. Quantitative binding assays showed thatHCR ... BoNT ⁄ D-SA, BoNT ⁄ D-South Africa; GBL, ganglioside- binding loop; GBP, ganglioside- binding pocket; HC, heavychain; HCR, heavy chain receptor -binding domain; HCT, heavy chain translocation domain...

Báo cáo khoa học: The enzyme-binding region of human GM2-activator protein pdf

... phosphatidic acid (20 mol%),2-NBD–GM1 (2 mol%) and rhodamine–PE (2 mol%).Acceptor vesicles comprised PtdCho (60 mol%), Chol(20 mol%) and phosphatidic acid (20 mol%). The ﬁnaldonor vesicle concentration ... sequencing kit, both fromApplied Biosystems (Foster City, CA). Recombinant bacu-loviruses were then generated by cotransfection of Sf9 cellswith the respective transfer vector and linearized BaculoGoldviral ... asrecommended by the manufacturer.SPR spectroscopyBiomolecular interaction analyses (BIA, SPR spectroscopy)were carried out at 25 C with a Bialite instrument (Bia-core) on a Pioneer L1 Chip....

Báo cáo khoa học: "Deciphering Foreign Language by Combining Language Models and Context Vectors" pdf

... ofthe active candidates and their respective probabili-ties are already correct, we induce new active candi-dates. In the context of information retrieval, Saltonet al. (1975) introduce a document ... a new trainingprocedure whose critical parts have constant time and memory complexity with respect to the vocab-ulary size so that our methods can scale to muchlarger vocabulary sizes while ... LinguisticsDeciphering Foreign Language by Combining Language Models and Context VectorsMalte Nuhn and Arne Mauser∗ and Hermann NeyHuman Language Technology and Pattern Recognition GroupRWTH Aachen...

Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf

... connective tissue growth factor(CCN2 ⁄ CTGF) promoter and activated transcriptionof CCN2 ⁄ CTGF. This growth factor promotes physio-logical chondrocytic proliferation and ECM formation.Pro- and ... theCSPG core protein will have altered biochemical prop-erties compared to unbound active MMP-9. Suchproperties may include substrate speciﬁcity, catalyticefﬁciency and ability to interact ... process theestrogen receptor b [142].Storage in exocytic vesiclesPolymorphonuclear leukocytes and mast cells can storeMMPs, as well as other proteinases and PGs, in exocy-tic vesicles and...

Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf

... in China. In the following sections we will discuss inter-dialect MT with special emphasis on the pair of Chinese Cantonese and Chinese Mandarin. 1 Dialects and Chinese Dialects Dialects ... selected to represent both input and output sentences, because in China pinyins are the most popular tools to learn dialects and to input Chinese characters to computers. Chinese pinyin schemes, ... pronunciation and in characters, our discussion will concentrate on word disambiguation for Cantonese-Mandarin MT. In the Cantonese vocabulary, there are about seven thousand to eight thousand...

Báo cáo khoa học: "Aflexible distributed architecture for NLP system development and use" pdf

... distributed architecture for NLP system development and use Freddy Y. Y. Choi Artificial Intelligence Group University of Manchester Manchester, U.K. choif@cs.man.ac.uk Abstract We describe a ... Engineering Architec- ture. architecture and techniques that are more gen- erally applicable, and it is these which we will focus on in this paper. 2 Architecture I System input and output ... sufficient control for developers. LTGT and GATE are both open-source C ap- plications. They can be recompiled for many platforms. TEA is a Java application. It can run directly (without compilation)...

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

... ABCB1, ABCC1 and ABCG2. Speciﬁcally, ABCG2 has been implicatedin clinical multidrug resistance in acute myeloid leu-kaemia [5–8]. However, although ABCB1 and ABCC1have been extensively characterized, ... thank TMW and DCS for critical assessment of allaspects of the project.References1 Mellor HR & Callaghan R (2008) Resistance to chemo-therapy in cancer: a complex and integrated cellularresponse. ... Thepotency of TNP-ATP to displace [3H]daunomycin binding was characterized by IC50= 0.27 ± 0.02 mm,which is 44-fold greater than that of ATP -c- S.Both TNP-ATP and ATP -c- S cause a decrease...

Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf

... Palla3, Flora Peyvandi3,Cosimo Altomare2 and Pier Mannuccio Mannucci31 Haemostasis Research Centre, Institute of Internal Medicine and Geriatrics, Catholic University School of Medicine, Rome, ... withinthe A-chain and between the A- and B-chains occursmainly through salt bridges and H bonds involvingcharged side chains. The A-chain is intramolecularlycross-linked by ﬁve side-chain electrostatic ... W60d side chain (S2 site) and shifting of W215 (S3). Functional and computationaldata show that the catalytic cycle and efﬁcient interac-tion with substrates and natural inhibitors by DK9undergo...

Báo cáo khoa học: pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein – characterization and regulation by uridine and guanosine nucleotides potx

... caldolyti-cus, which we called BcBL1, BcBL2 and BcBL3, and the effects of nucleotides on RNA binding. A rapid and convenient ﬁlter binding assay [14] was used formany of these experiments. Electrophoretic ... lgÆmL)1of acety-lated BSA, nucleotides at the indicated concentrations and various concentrations of native B. caldolyticus PyrR,which was puriﬁed as described previously [10]. The con-centration ... uridine nucleotide con-centrations on binding of PyrR to BcBL2. The total concentration ofnucleotides was held constant at 1 mM.Concentrationof nucleotide(lM)Kdvalue forRNA (nM)Concentrationof...

Báo cáo khoa học: Transcription factor speciﬁcity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

... TGTGGCTCTGTGGAACATTTSp1FP GGACTACCTGGAGTGATGCCTAASp1RP CCCATCAACGGTCTGGAACTAP-2aFP CAACGTTACCCTGCTCACATCA Real-time PCRAP-2aRP CAGGTCGGTGAACTCTTTGCAb-actinFP GCGCGGCTACAGCTTCAb-actinRP CTTAATGTCACGCACGATTTCCFig. ... CCAAGCTTCGGACTGAGAGAGGCAGGAAP()609 ⁄ +30)-F1 GGGGTACCTGGAGCACACACGCCAGATCP()343 ⁄ +30)-F2 GGGGTACCCGACGCACTACCGCCATCGTP()241 ⁄ +30)-F3 GGGGTACCCTTCTTCGCCCGGGAAGGAAP()203 ⁄ +30)-F4 GGGGTACCGCAGCTGAAATAGCGGAGGT MutagenesisP()108 ... ChIPSp1 ⁄ chipF GGACTACCTGGAGTGATGCCTAA ChIPSp1 ⁄ chipR CCCATCAACGGTCTGGAACT ChIPAP-2a ⁄ si GCUCCACCUCGAAGUACAATT RNAiSp1 ⁄ si NNAGCGCUUCAUGAGGAGUGA RNAiKCTD10FP TTGCGGTTTAGGTACATCCAKCTD10RP...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Chuong 2 nhận dạng rui ro Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam