... vector, containing a 788-base pair fragment amplified from the human genomic GAPDH gene [20]. GAPDH mRNA was utilized as a constant mRNA for control. Statistical analysis The statistical analysis of the ... Regulation of Ras. GTP loading and Ras–Raf association in neonatal rat ventricular myocytes by G protein-coupled receptor agonists and phorbol ester. Activation of the extra...
Ngày tải lên: 21/02/2014, 01:21
... fi nancial institutions as a way to address specifi c banks’ solvency threats (e.g. Belgium, the Netherlands, Luxembourg and Ireland). Over and above guarantees and recapitalisation measures ... systemic fi nancial crises in advanced economies (Spain, Finland, Norway, Sweden and Japan). The shaded range of normal cycles is demarcated by the lower and upper quartiles. The...
Ngày tải lên: 06/03/2014, 09:22
Research " A Comparative Study of returns to education and the Importance of Genetic and Environment Factors: Evidence from Different twins data " ppt
...
Ngày tải lên: 16/03/2014, 03:20
Báo cáo y học: "Randomized trial comparing daily interruption of sedation and nursing-implemented sedation algorithm in medical intensive care unit patients"
... design, data analysis and interpretation, and drafting of the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors wish to extend their gratitude to the nurses ... included reintubation (DIS 8 and SA 5), death on MV or medical treatment withdrawn (DIS 8 and SA 6), tracheostomy (DIS 2 and SA 0), and study withdrawal (DIS 6 and SA...
Ngày tải lên: 25/10/2012, 10:35
Tài liệu THE UNITED REPUBLIC OF TANZANIA NATIONAL POPULATION POLICY INISTRY OF PLANNING, ECONOMY AND EMPOWERMENT 2006 pptx
... rural areas both males and females marry much earlier than the national average age of first marriage. But in the urban areas it is the opposite for they marry at a later age than their rural ... forests and woodland, 40 percent by grassland and scrub and only 6-8 percent is cultivated. Aquatic resources include Lakes Victoria, Tanganyika and Nyasa and other small inland l...
Ngày tải lên: 13/02/2014, 10:20
Tài liệu Graphics and Animation on iOS: A Beginner''''s Guide to Core Graphics and Core Animation pptx
... (for initialization) Uses the given parameter as the path to an image that has to be loaded and used to initialize the image object. This path should be the full path to the image in the app bundle. initWithData: ... games and other apps. When the iOS runtime and Cocoa programming frameworks combine, they make an amazing variety of graphics and animation effects possible...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... 8 both forward ACAACACCACTGCTGCGGAGTTA J1F 9 short reverse ACATCAAGGAGCGTTAGAATCTAA J2R 1201 (with J1F and J2R) 10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 1385 (with J1F and J3R) Real tim...
Ngày tải lên: 19/02/2014, 02:20
MARKETING DURING A DOWNTURN: INSIGHTS INTO HOW MARKETERS ARE HANDLING THE SLUMP pot
... agency. More and more recognize that they don’t need to separate branding and direct marketing budgets because they can acquire and brand at the same time, Sable says. Additionally, some of the increase ... 19% are increasing brand investments. Direct marketing is more measurable and trackable in terms of ROI. It also aims to get the company’s name, brand and message in fro...
Ngày tải lên: 06/03/2014, 21:20
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... between recombination and chromatin assembly during meiosis Satomi Ishii* , †, Akiyo Koshiyama*, Fumika N. Hamada, Takayuki Y. Nara, Kazuki Iwabata, Kengo Sakaguchi and Satoshi H. Namekawa Department of Applied ... exonu- clease activity and invades the homologous double- stranded region of the other allele. These steps of homology search and recombination are catalysed by two b...
Ngày tải lên: 07/03/2014, 05:20
Support to woman by a companion of her choice during childbirth: a randomized controlled trial potx
... important to emphasize that this is not a study about doulas and if on one hand there is a general belief that a labor companion has always positive effects, there are,, on the other hand still a ... preparation. Therefore, the assistance the women in both groups received during labor and delivery was the standard care routinely pro- vided in that hospital, and there w...
Ngày tải lên: 14/03/2014, 16:20