Báo cáo "On the Oscillation, the Convergence, and the Boundedness of Solutions for a Neutral Difference Equation " pot

...

Ngày tải lên: 22/03/2014, 11:20

... differential equations of neutral type, J. Math. Anal. Appl, Vol. 18 (1967). [2] L. H. Huang and J. S. Ju, Asymptotic behavior of solutions for a class of difference equation, J. Math. Anal. Appl., ... oscillations for neutral delay difference equation, J. Math. Anal. Appl. Vol. 166 (1992). [6] B. S. Lalli and B. G. Zhang, Oscillation and comparison theorems fo...

Ngày tải lên: 14/03/2014, 13:20

... Colombian and Nigerian samples the Raman shift was around 1068-1070 cm -1 and in samples from Austria, Brazil, China, Madagascar, Russia, South Africa, Zambia, the Raman shift was around 1069-1072 ... Russia (Ural), Madagascar (Mananjary), South Africa (Transvaal), Zambia (Kafubu), Nigeria (Gwantu), China (Malipo) and synthetic ones from Tairus, Biron (hydrothermally-grown...

Ngày tải lên: 22/03/2014, 12:20

... orthogonal sources of evidence to create a state -of -the- art system for the task of WSD disam- biguation for AW. Our approach yields an over- all global F measure of 64.58 for the standard SV2AW data ... bank and saw many beautiful plants there.’ will have the verbs ‘walked, saw’, the nouns ‘bank, plants’, the ad- jectives ‘many, beautiful’, and the adverb ‘th...

Ngày tải lên: 17/03/2014, 00:20

... supernatant contained the protein extract. HLA-DR standard, cell lysates and plasma samples were separated using a Mini-PROTEAN® II. The separation gel was a 14% polyacrylamide gel (National Diagnostics, ... sequence. The primers were designed using Primer Select software (DNA Star). Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Si...

Ngày tải lên: 03/11/2012, 09:57

... information on antibody fragments and nonantibody small scaffold proteins from X-ray and NMR analyses enables the design of and screening for small binding proteins. The preparation of the small ... Fab had high affinity for human VEGF (K d =60nm). X-ray structural analysis of the complex of another Fab and human death receptor 5 confirmed the importance of Tyr r...

Ngày tải lên: 06/03/2014, 11:20

... CATCGTCATGTTTGAACC RTWF5.1/3¢ GYLNAA a GGCCGCATTGAGATAACC WFZ (Y1) RTWF5.1/5¢ IVMFEP CATCGTCATGTTTGAACC RTWF5. 1a/ 3¢ PFIKPR a CCTGGGTTTAATAAATGG Actin ActF(WF) AALVVD TCGCTGCCCTCGTTGTTGAC ActR(WF) VLLTEAP a GGAGCCTCGGTCAGCAGGA a Primer ... AP-1 factors are involved in cell differenti- ation and survival and are also produced after viral transformation of cells. The presence...

Ngày tải lên: 31/03/2014, 07:20

... interactions via its side chain, and is in a similar position to Glu132 in A. thaliana PS. Val111 and Gly113, on the other hand, are both affected by both pantoate and ATP. These residues have their ... Srini- vas for help with preparing the clone of nPS, A. Aro- ra, CDRI, Lucknow, for help in collecting the relaxation data, and N. Srinivasan and S. Yamunadevi for...

Ngày tải lên: 16/02/2014, 09:20

... F,W angles far from the allowed Ramachandran region, are virtually identical to that of FVIIa. Model- ling of Ala372(223) into FVIIa showed that the Cb atom clashed with that of Arg315(170C), and ... procoagulant activity that triggers the clotting cascade [1,2]. Importantly, formation of the binary complex localizes FVIIa to the site of vascular damage, positions the...

Ngày tải lên: 18/02/2014, 08:20

... of cADPR are still a matter of debate. An ADPRC that acts mainly as a cyclizing enzyme has been purified and cloned more than 10 years ago from the ovotestis of Aplysia californica [19,20]. Mammalian ... On the other hand, ectoenzymes producing cADPR (such as CD38 and CD157) and transport systems for cADPR in the plasma membrane open the possibility that cADPR acts as...

Ngày tải lên: 20/02/2014, 01:20