Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx

... sequence Method R74I 5¢-CCCGTCCCCACCATGATCCGCGGCTTCACCGGG-3¢ USE R74Q 5¢-CCCGTCCCCACCATGCAGCGCGGCTTCACCGGG-3¢ USE R75I 5¢-CCCGTCCCCACCATGCGCATCGGCTTCACCGGG-3¢ USE R75Q 5¢-CCCGTCCCCACCATGCGCCAGGGCTTCACCGGG-3¢ ... 5¢-CCCGTCCCCACCATGCGCCAGGGCTTCACCGGG-3¢ USE R160Q 5¢-TAGCGGAACTGCAGCAGCG-3¢ Kunkel R162A 5¢-CGCTGCTGCGGTTCGCATACTTCCCGCAGGTC-3¢ PCR R162Q 5¢-CGCTGCTGCGGTTCCAATACTTCCCGCAGGTC-3¢ PCR R2...

Ngày tải lên: 18/03/2014, 01:20

... only in the case of cathepsin B binding. The contribution of the second binding loop of cystatin A to protease binding varies with the protease, being largest,  45% of the total binding energy, ... Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATA...

Ngày tải lên: 17/03/2014, 10:20

... substrate binding residues bP22(CB) and bF24(CE2), respectively. Changing the acyl binding site by mutagenesis may in uence the synthetic capacities of PA in different ways. The relative affinity of the ... of Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, the Netherlands Penicillin acylase of Escherichia...

Ngày tải lên: 17/03/2014, 23:20

... efficiently by ligation to zinc indicating that some aspects of the zinc ligand environment are sur- prisingly uncritical for coenzyme M binding. Keywords: 11 zinc enzymes; methanogenic archaea; methyl transferases; ... absence and presence of coen- zyme M, indicate how zinc interacts with its substrate coenzyme M and how zinc is most probably coordinated in the active site...

Ngày tải lên: 17/03/2014, 23:20

... specifically investigated the epidemiology of sodium disturbances in the intensive care unit (ICU). The objectives of this study were to describe the incidence of ICU-acquired hyponatraemia and hypernatraemia and ... cardiopulmo- nary resuscitation (CPR), comfort care). Severity of illness at inception (within the first day of ICU admission) was assessed using the...

Ngày tải lên: 25/10/2012, 10:31

... that the cytosolic RNase inhibitor (cRI) plays a major role in determining the ability of an RNase to be cytotoxic. However, to interact with cRI RNases must reach the cytosol, and cross intracellular ... displays cytotoxic activity on eukary- otic and bacterial cells [32]. Given the recently reported cytotoxic activity of the noncovalent dimers of RNase A [17], intrig...

Ngày tải lên: 19/02/2014, 06:20

... GAT1 In order to gain further insight into the role of the terminal structures of the N-glycans of GAT1, N-gly- cosylation processing of NNN was inhibited by 1-de- oxymannojirimycin (dMM). Inhibition ... modification may in uence many of the physicochemical and biological proper- ties of the proteins, such as protein folding, stability, targeting, dynamics and...

Ngày tải lên: 19/02/2014, 17:20

... fu- ture of QA research. Other types of complex needs include analytical questions such as “How close is Iran to acquiring nuclear weapons?”, which are the focus of the AQUAINT program in the U.S., and opinion ... Previously, they were the focus of a small pilot study within the AQUAINT program, which resulted in an understanding of a “relationship” as the ability...

Ngày tải lên: 08/03/2014, 02:21

... unfolding and refolding of s-MDH using activity assay, fluorescence, far-UV and near-UV circular dichroism (CD) spectroscopy, hydrophobic probe-1-anilino- 8-napthalene sulfonic acid binding, dynamic ... When incubated with increasing concentrations of GdnHCl there is a decline in the far-UV CD signals reflecting the gradual loss of the secondary structure of the protein....

Ngày tải lên: 08/03/2014, 23:20

... novo synthesis from b uilding blocks, glutamate, cysteine, and glycine, via two ATP-con suming s teps involving c- g lut- amylcysteine synthetase ( cGCS) and glutathione synthetase. The other constitutes ... intensity of the bands for the protein and the mRNA were faint. Effects of inhibitors of cGCS and GR on primary cultured testicular cells To investigate t he contri...

Ngày tải lên: 17/03/2014, 17:20