Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... histidine kinases may either be the consequence of a decrease in the histidine kinase activity, or, alternatively, of an increase in an intrinsic autophosphatase activity present in the BvgS and EvgS proteins ... EvgS. As the quinones are the only components of the respiratory chain which apparently are free in their movement within the membrane, they ma...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: Herbaspirillum seropedicae signal transduction protein PII is structurally similar to the enteric GlnK potx
... a wavelength of 1.38 A ˚ , using a MAR 345 imaging plate on the protein crystallography beamline [28,29] at the Brazilian National Synchrotron Laboratory (Campinas, Brazil). The crystal initially ... nucleotide diphosphate kinase, RNA binding protein, ribosomal protein, allosteric domain of the regulatory subunit of aspartate transcarbamylase, a viral transcriptional reg...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "Parvovirus B19 Genotype Specific Amino Acid Substitution in NS1 Reduces the Protein’s Cytotoxicity in Culture"
... R- 5’ GGCCATCTAGATTACTCATAATCTACAAAGCT PathT - PRMTTA 1- 5’ AGTATCATTTATGGCTACGGTAATG 2- 5’ ATTACCGTAGCCATAAATGATACTAGTAG Baculovirus Transduction of HepG2 Cells. HepG2 cells ... FlowJo software (Tree Star, Inc, Ash- land, OR). Cytotoxicity Assay. Trypan blue dye exclusion was used to determine cell viability. Adherent and loose HepG2 cells were collected by trypsi...
Ngày tải lên: 26/10/2012, 09:32
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... 5¢-CGCG CCATGGTGAAAACAGCAATTGTAACT-3¢ (NcoI) and 5¢-GCGCCCCGGGAAAAGAAAAACC-3¢ (SmaI); andtosubclonethetld gene into the vector pIVEX2.3MCS, 5¢-GCGCCATATGAAAATCTTAGTA-3¢ (NdeI) and 5¢-GCGCCCCGGGAATCGAAAGCTC-3¢ (SmaI). Each PCR ... broad range of bacterial species. The polysaccharides often constitute the outermost layer of the cell, and have been implicated as an important fa...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Irregular spiking in free calcium concentration in single, human platelets Regulation by modulation of the inositol trisphosphate receptors ppt
... used to measure mass amounts of InsP 3 with a Biotrak radioreceptor assay system (Amersham-Pharmacia, UK). Freshly dissolved InsP 3 was taken as a standard. Statistics Paired data were compared for ... of the platelets ( areas 0.8 · 2.5 lm). (C) Histogram of variation in peak -to- peak interval of 15 responsive platelets. (D) Plot of total duration of individual peaks...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo y học: " Regional coordination in medical emergencies and major incidents; plan, execute and teach"
... Västra Göta- land to Lebanon, Cyprus and Syria as well as to coordinate all possible secondary air Medevacs of Swedish citizens brought from the area to Stockholm/Arlanda airport. Other long-lasting ... PKMC's command and control centre (24 h/day) dur- ing 21 days, involving all staff. PKMC was tasked by the National Board of Health and Welfare to send medical teams...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: " Non-invasive stroke volume measurement and passive leg raising predict volume responsiveness in medical ICU patients: an observational cohort study"
... had full access to all of the data in the study and takes responsibility for the integrity of the data and the accu- racy of the data analysis. Acknowledgements This study received no financial ... dilemma facing physicians caring for critically ill patients. Static markers of cardiac preload are poor predictors of volume responsiveness, and dynamic markers ar...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"
... interviews and self- administered questionnaires on lifestyle and health related factors, medical history and respiratory symptoms were performed. Cardiovascular (heart attack, stroke) and pul- monary ... [21]. In the respiratory system most of the b-ARs are b2-ARs. However, there are b1-ARs, too, which are responsible for the respiratory effects of cardioselective b1-...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo y học: "Relationship between Anti-CCP Antibodies and Oxidant and Anti-Oxidant Activity in Patients with Rheumatoid Arthrit"
... the study after having a preliminary evaluation consisting of a brief medical history, smoking and alcohol habits and physical examinations. Inflammatory disease activity was defined as a ... appear to be of value for the diagnosis and especially severity of RA [10], and also closely correlated to inflammatory disease activity (Disease Activity Score-DAS28) s...
Ngày tải lên: 25/10/2012, 11:15
Báo cáo y học: "Pathogenic Mechanisms Shared between Psoriasis and Cardiovascular Diseas"
... vessel and adhere to endothelium. Extravasation occurs mediated by LFA-1 and ICAM-1 (or CD2 and LFA-3) and activated T-cells interact with dendritic cells (and macrophages and keratinocytes in ... of atherosclerosis which is a hallmark of cardiovas- cular disease and in which inflammation plays a ma- jor role [7, 8]. In addition, the same factors are also implic...
Ngày tải lên: 25/10/2012, 11:40