Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc
Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc
... equivalent in the other language, as many entries as necessary arecreated.3 Evaluation The evaluations of the Slovenian part of the dic-tionary concern its coverage of a) the corpus of the Slovenian ... under-stand of the lexical content of the newspaper text.In the case of non-related lemmas, one of themis usually much more frequent (as with avto and avt), whereas in the case of related ... Slovenian, the text is spell-checked and proof-read, the error-rateis low (Jakopin, 2002). The results of our evalu-ation will give an approximation of how well the lexical knowledge represented in the...
- 4
- 321
- 0
Báo cáo khoa học: Structure and activity of the atypical serine kinase Rio1 doc
... nucleotidebinding. These include the YL and RF motifs from the flexible loop (Fig. 1D), the Trp116, Lys119,Arg122 and Asn123 from aC, Gln215 of the catalyticloop and the HP motif between b10 and aF. All theseresidues, ... between Rio2 and the beginning of the flexible loop. The difference in the length of the hingeregion between Rio1 and Rio2 is due to an insertion of a b-hairpin in Rio1 that closes off the active ... with the uncomplexed protein. Com-parisons of the structure of Rio1 with the previously determined structure of the Rio2 kinase defined the minimal RIO domain and the distinct fea-tures of the...
- 16
- 315
- 0
Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf
... labels and parts -of- speech of the treebank parse. The second candidate parse is incorrect, since two of its part -of- speech labels and one of its bracket labels differ from those of the treebank ... parse is, then, the follow- ing. Given a pair of nonterminals B and C in the CKY chart, if the span of the parent is not structure-consistent then this occurence of B C cannot be used in the parse ... similar task and reported 30% of input sentences as having been correctly parsed. On the basis of the pre- ceeding evidence it seems that the current state of the t At least one of the parties...
- 8
- 562
- 0
Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx
... advantage of p53 mutation analysis, and a unique feature of this database, is the availabil-ity of the residual activity of the majority of p53 mis-sense mutants. The biological activity of mutant ... prediction of the severity of p53 mutants. The method was trained on a set of known mutants and subsequently evaluated on anotherset. The method is based on parameters reflecting the bio-chemical and ... powerful method, and several algorithms have been developed recently [4–7]. The major drawback of these analyses is the lack of information regarding the activity or loss of activity of the target...
- 14
- 561
- 0
Báo cáo khoa học: Structure and mechanism of the ThDP-dependent benzaldehyde lyase from Pseudomonas fluorescens potx
... with the gene of the benzaldehyde lyase and for helpful discus-sions, the teams of the Swiss Light Source (Villigen ⁄ CH) and of the EMBL outstation Hamburg for their helpwith data collection and ... important for cofactor binding and catalysis. The BAL residues are labeled and the BAL hydrogenbonds are displayed. The yellow and red residues at the top are His70 of BFD and Asn28 of PDC, respectively. ... consist of a cen-tral six-stranded parallel b-sheet flanked by a varyingnumber of a-helices. Residues involved in binding of the cofactor ThDP are located at the C-terminal ends of the b-strands of...
- 10
- 454
- 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot
... intensity of the bandsmay be the result of a different copy number of the genes in the hybridizing fragments. If so, the number of the bands donot represent the family size. Thus, the mlp gene ... Leu117)or Met (Met153 of the ML1p and ML2p B-chains and Met156 of the ML3p B-chain corresponding to the ricinB-chain Leu152; and Met234 of the ML1p and ML2pB-chains corresponding to the ricin B-chain ... quantitativeratio of the amplification products of the three gene variantsin the amplified fragment was assessed by calculation of the ratio of radioactivity of the corresponding bands.Quantitative PCRThe...
- 11
- 610
- 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx
... experimentally. Indeed, the presence of Arg213 along with the proximity of the chargerelay Asp260 within the active site could be responsible for the modification of the catalytic properties of the catalytichistidine. ... avor the displacement of the equilibriumtoward the neutral state of His290.To attest this hypothesis, an Arg213Ala mutant has beenexpressed and characterized. The specific activity of the Ala213 ... [23].Results and DiscussionCloning and expression of Rv1399c The Rv1399c gene product encodes a 318 amino acidprotein with a molecular mass of 31.7 kDa and acalculated pI of 4.53 and belongs to the...
- 9
- 584
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... were present in the 3¢-UTR as well as in the 5¢-UTR, and four potentialpoly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining ... organizationresembles that of mammalian IL-11. The sequencesbetween the trout cDNA and genomic DNA in the coding region are identical, although there were differ-ences in both the 5¢- and 3¢-UTR. The major ... differ-ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1).A...
- 12
- 511
- 0
Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx
... these 21 consonants.On the other hand Regime 2 of Figure 3(a) as wellas Regime 1 of Figure 3(b) comprises of the rest of the consonants. The point marked as x in both the figures indicates the ... correspondingto the nodes in the set VL and the other corre-sponding to the nodes in the set VC.Degree distribution of the nodes in VL: Fig-ure 2 shows the degree distribution of the nodesin ... VLwhere the x-axis denotes the degree of eachnode expressed as a fraction of the maximum de-gree and the y-axis denotes the number of nodeshaving a given degree expressed as a fraction of the...
- 8
- 550
- 0
Báo cáo khoa học: Structure and topology of the transmembrane domain 4 of the divalent metal transporter in membrane-mimetic environments docx
... in the presence of Gd3+at pH 4.0, but the degree to which the intensities recovered was lower in the presence of Gd3+,particularly for the C-terminal residues, than in the presence of the ... suggeststhat the C-terminus of the peptide is partially embedded intoSDS micelles at pH 4.0, which may therefore block the entrance of either solvent molecules or metal ions. The movement of the C-terminus ... toexplore the molecular biology aspects of DMT1 since the discovery of this gene, there has so far been no structuralcharacterization of either this integral protein or a segment of it. Analysis of the...
- 14
- 486
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP