Báo cáo khoa học: "Free Indexation: Combinatorial Analysis and A Compositional Algorithm*" doc

... Free Indexation: Combinatorial Analysis and A Compositional Algorithm* Sandiway Fong 545 Technology Square, Rm. NE43-810, MIT Artificial Intelligence Laboratory, Cambridge MA 02139 Internet: ... course, a compositional algorithm can also be used in the non-interleaved case. Basically, the algorithm works by maintaining a set of indices at each sub-phrase of a par...

Ngày tải lên: 17/03/2014, 20:20

... CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG LdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCC T. Ogura et al. Molting ... WSNGGNTAYCAYTAYAAYGC LdUSP-F1 ATHTGYGGNGAYMGNGC LdEcR-F2 GARGGNTGYAARGGNTTYTT LdUSP-F2 GGNAARCAYTAYGGNGTNTA LdEcR-F3 TGMGNMGNAARTGYCARGARTG LdUSP-R1 TCYTCYTGNACNGCYTC LdEcR-R1 TCNSWRAADATNRCNAYNG...

Ngày tải lên: 07/03/2014, 21:20

... Plurk to automatically extract posts with positive and negative opinions. We collect 10,000 positive and 10,000 negative posts as training data to train a language model of Naïve Bayes classifier, ... observe that some posts contain charac- teristics of both Interrogation and Sharing. The users may share a hyperlink and ask for others’ opinions at the same time. We create a...

Ngày tải lên: 17/03/2014, 00:20

... 3915 Germany), p53 (BD Biosciences, San Jose, CA, USA), c-Jun as well as CK 2a (Calbiochem, Schwalbach, Germany), p27 as well as IjBa (Santa Cruz, CA, USA) and cullin 1 (Onco- gene, Schwalbach, Germany) ... CSN2 and for the PCI domain of its lid paralog Rpn6 (amino acids 291–422). (B) The Flag-CSN2-Rpn6 chimera was stably expressed in B8 cells and the cell lysate was analyzed by glycer...

Ngày tải lên: 20/02/2014, 01:20

... passages for 36 queries that relate to biological events and processes. Firstly, we processed the documents with a conventional tokenizer and standard stop-word remover, and then created an ... by comparable existing resources. Figures 1 and 2 show the percentage of the terminological words and derivational relations (such as the word retroregulate and the derivational r...

Ngày tải lên: 22/02/2014, 02:20

... proposed a Bayesian approach in an archaeological decipher- ment scenario. These methods are attractive for their ability to manage uncertainty about model parame- ters and allow one to incorporate ... on Natural Language Processing of the Asian Federa- tion of Natural Language Processing (ACL-IJCNLP), pages 782–790. David Chiang, Jonathan Graehl, Kevin Knight, Adam Pauls, and Sujith Ra...

Ngày tải lên: 07/03/2014, 22:20

... beta-keto-l-gulonic acid. Biochim Biophys Acta 52 , 170–175. 78 Nakagawa J, Ishikura S, Asami J, Isaji T, Usami N, Hara A, Sakurai T, Tsuritani K, Oda K, Takahashi M et al. (2002) Molecular characterization ... Board PG, Whitbread AK, Tetlow N, Cavanaugh JA, Blackburn AC & Masoumi A (2005) Characterization of the monomethylarsonate reductase and dehydroascorbate reductase activities...

Ngày tải lên: 16/03/2014, 12:20

... recent years. Typical domain adaptation tasks often assume annotated data in new domain absent or insufficient and a large scale unlabeled data available. As unlabeled data are concerned, semi-supervised ... essentially different from that. As Chinese is basically a character-based written language. Character plays an important role in many means, most characters can be formed as single-...

Ngày tải lên: 17/03/2014, 01:20

... Dhillon and Lyle H. Ungar Computer and Information Science University of Pennsylvania, Philadelphia, PA, U.S .A {pasingh,ungar}@seas.upenn.edu Abstract We propose a novel approach for improv- ing Feature ... setting e.g. (Florian and Yarowsky, 2002) and feature selection has always been an important component of high accuracy word sense disambiguation, as one often has thou- sands...

Ngày tải lên: 17/03/2014, 02:20

... Netherlands) and 3 lL of cDNA template (equivalent to 1 ng of RNA). Amplification, data acquisition, and data analysis were car- ried out in the ABI 7900 Prism Sequence Detector (once at 2 min, ... the capacities of hexokinase (HXK), aldolase (ALD), PGK, GPM, PYK and pyruvate decarboxylase (PDC) were upregulated. The capacity of alcohol dehy- drogenase (ADH) was downregulated and the...

Ngày tải lên: 18/02/2014, 06:20