Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

... THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR Bruce W. Ballard Dept. of Computer Science Duke University Durham, N.C. 27708 ABSTRACT ... complex domains are a 2~al gTz, des domain, giving course grades for students in an academic department, and a bu~di~tg ~rgsvtizatiovt domain, containing information on the floors, wings, corridors, ... in ACQUIRING VERBS FOR STUDENT: A STUDENT CAN pass a course fail a course take a course from an instructor make a grade from an instructor make a grade in a course In Stage 2, Prep learns...

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... and 4) high molecular mass bands of approximately 110 kDa and > 200 kDa were visible, as well as a faint band at37 kDa, suggesting the presence of dimers. All of the bandsstained positively ... intenseband of 61 kDa (NrfA) and a band of weak intensity of 19 kDa (NrfH), conﬁrming its hetero-oligomeric nature(Fig. 1, lane 1).However, in the absence of boiling (Fig. 1A, lanes 2 and 4) ... compriseCytc_DdesCytc_DgigNrfH_WsucNrfH_SdelNrfH_DdesCymA_SputNapC_RsphNapC_PpanNapC_AbraNapC_Paer VDAPADMV.IKAPAGAKVTKAPV AFSHKGHASM VDVPADGAKIDFIAGGE.KNLTV VFNHSTHKDV MNKSKFLVYSSLVVFAI ALGLFVYLVNASKALSYLSSDPKACI NCHVM. NPQYAT MKNSNFLKYAALGAFIVAIGFFVYMLNASKALSYLSSDPKACI...

Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf

... Structure and Process of Talking About Doing James A. Levln and Edwin L. Hutchins Center for Human Information Processing University of Callfornia, San Diego People talk •bout what they do, often ... correlation ~etween Point or view and errors in problem solving actions. Subjects in the ~tlsslonarles and Cannibals task can make errors by Cabin| actions that violate the constraints ... pt left and eaten. So beth mAeeloaar~oe oeme book " One XntoreatAng ~Ant about 5h ~a ~rt~e~ar example %8 5hat ~t %e embedded wlthAn an "el~mlnatAon of alternat£voo" arll~Nnt...

Báo cáo khoa học: "The Computational Lexical Semantics of Syntagmatic Relations" pptx

... pects of natural languages. The focus has been on grammatical collocations such as adapt to, aim at, look ]or. Lakoff (1970) distinguishes a class of ex- pressions which cannot undergo certain ... has been applied among other languages to Russian, French, German and English. the collocational information is listed in a static way. We believe that one of the main drawbacks of the ap- ... (Smadja, 1993), and then checked by a human. pay attention, meet an obligation, commit an offence, dance marathon, marriage ceremony object of derision LSFs and Inheritance We take advantage...

Báo cáo khoa học: The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group docx

... Proc Natl Acad Sci USA88, 8317–8321.49 Kawabata S, Kuwata H, Nakagawa I, Morimatsu S,Sano K & Hamada S (1999) Capsular hyaluronic acid of group A streptococci hampers their invasion into ... one of the leading causes of human gastroenteritis and surpasses Salmonella, Shig-ella and Escherichia in some regions as the primarycause of gastrointestinal disease [1–3]. There is also a convincing ... and gastroenteritis. J Infect Dis 184,215–220.43 Ninomiya T, Sugiura N, Tawada A, Sugimoto K,Watanabe H & Kimata K (2002) Molecular cloning and characterization of chondroitin polymerase...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT ... GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial PCRZffoxp3-F2 TGCCACCTTTTCCATCATACA Initial PCRZffoxp3-R2 CTGCTTTTCTGGGGACTTCA Initial ... vertebrates.Signiﬁcant homology was seen in the putative T-boxDNA-binding domain of t-bet, the STAT protein inter-action domain, STAT protein all-alpha domain, STATprotein DNA-binding domain and SH2 domain of stat6,...

Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

... reductaseSREBP-2NADPHPyruvateAcetyl-CoACitrateacetyl-CoAOxaloacetateOxaloacetateACLACCHMG-CoAHMG-CoA synthaseCitrateMalonyl-CoAPalmitateMalateMitochondriaFASACCSCDFatty acid synthesisStearateElovl6acyl-CoAGlycerol-3-phosphate1-acylglycerol-3-phosphateCoACytosolGPATSCDFeedforwardSREBP-1TriglycerideDGATFig. ... deﬁned.SREBP and parasympathetic function in heartParasympathetic stimulation of the heart involvesactivation of GIRK1 ⁄ 4, a G-protein-coupled inward-rectifying potassium channel, and results in anacetylcholine-sensitive ... Regulation of SREBP-1c by saturated fatty acids and PU-FAs. Saturated fatty acids activate, and PUFAs suppress, SREBP-1c, leading to and protecting from hepatic insulin resistance and pancreatic...

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elaﬁn) do not depend on its protease inhibitory function pptx

... analysis of elaﬁn and trappin-2 fractionatedon heparin-Sepharose. The heparin-binding capacities of elaﬁn and trappin-2 were evaluated by afﬁnity chromatography using heparin-Sepharose. Elaﬁn ... pneumoniae, Branhamella catarrhalis and thepathogenic fungi A. fumigatus and C. albicans. Ourresults indicate that trappin-2 has a broad antibacte-rial activity and is fungicidal for A. fumigatus ... N-terminal domain and is comparable to that of human defensins and human lysozyme.Elaﬁn and trappin-2 are both antimicrobial againstS. aureus and P. aeruginosa [14,15] but not againstE. coli...

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... T, Maruy-ama M, Saito M, Yamada M, Takahashi H & Tsuji S(1999) A neurological disease caused by an expandedCAG trinucleotide repeat in the TATA-binding proteingene: a new polyglutamine ... evolution of thisfamily.Evolution based on domain reusing might explainthe abundance of certain protein domains and is a way of easily increasing the number of TFs, as appears tohave occurred ... functional features and the features are gener-ated by two distinct evolutionary strategies: ampliﬁcation and shufﬂing of interacting domains through tinkering and acquisition of speciﬁc interact-ing...

Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf

... contained in Spirochaetaaurantia LGLBare either branched or unsaturated. Values stated a re theaverage n molÆmg)1with standard deviations (±) obtained fromquantifying and averaging areas under ... identiﬁcation of lipopolysaccharides and immunodeterminan ts in pathogenic strains of Haemophilis in u-enzae; application to clinical isolates. In Mass Spectrometry in Biology and Medicine (Burlingame, ... ELISAs were d evelopedby using o-phenylenediamine as a substrate, and theabsorbance was measured at 490 nm by using a Spectramaxplate reader and software (Molecular Devices, Sunnyvale,CA, USA)....

Xem thêm